ID: 1107156613

View in Genome Browser
Species Human (GRCh38)
Location 13:37174563-37174585
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107156610_1107156613 15 Left 1107156610 13:37174525-37174547 CCTTTTCATTCTCTCTCTATCTA No data
Right 1107156613 13:37174563-37174585 TTTCTATTTTACCACCTTCAAGG No data
1107156608_1107156613 26 Left 1107156608 13:37174514-37174536 CCTAGTCTCTCCCTTTTCATTCT No data
Right 1107156613 13:37174563-37174585 TTTCTATTTTACCACCTTCAAGG No data
1107156609_1107156613 16 Left 1107156609 13:37174524-37174546 CCCTTTTCATTCTCTCTCTATCT No data
Right 1107156613 13:37174563-37174585 TTTCTATTTTACCACCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107156613 Original CRISPR TTTCTATTTTACCACCTTCA AGG Intergenic