ID: 1107156614

View in Genome Browser
Species Human (GRCh38)
Location 13:37174572-37174594
Sequence TACCACCTTCAAGGTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107156611_1107156614 -5 Left 1107156611 13:37174554-37174576 CCCATTTATTTTCTATTTTACCA No data
Right 1107156614 13:37174572-37174594 TACCACCTTCAAGGTGATGATGG No data
1107156610_1107156614 24 Left 1107156610 13:37174525-37174547 CCTTTTCATTCTCTCTCTATCTA No data
Right 1107156614 13:37174572-37174594 TACCACCTTCAAGGTGATGATGG No data
1107156612_1107156614 -6 Left 1107156612 13:37174555-37174577 CCATTTATTTTCTATTTTACCAC No data
Right 1107156614 13:37174572-37174594 TACCACCTTCAAGGTGATGATGG No data
1107156609_1107156614 25 Left 1107156609 13:37174524-37174546 CCCTTTTCATTCTCTCTCTATCT No data
Right 1107156614 13:37174572-37174594 TACCACCTTCAAGGTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107156614 Original CRISPR TACCACCTTCAAGGTGATGA TGG Intergenic