ID: 1107164718

View in Genome Browser
Species Human (GRCh38)
Location 13:37270940-37270962
Sequence AGGGGCTGTCCTCACATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107164718_1107164725 20 Left 1107164718 13:37270940-37270962 CCTAGAATGTGAGGACAGCCCCT No data
Right 1107164725 13:37270983-37271005 CCCCAGTGTCAATAGTGCTGTGG No data
1107164718_1107164723 -3 Left 1107164718 13:37270940-37270962 CCTAGAATGTGAGGACAGCCCCT No data
Right 1107164723 13:37270960-37270982 CCTCATAACAAAGGATTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107164718 Original CRISPR AGGGGCTGTCCTCACATTCT AGG (reversed) Intergenic