ID: 1107164725

View in Genome Browser
Species Human (GRCh38)
Location 13:37270983-37271005
Sequence CCCCAGTGTCAATAGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107164721_1107164725 1 Left 1107164721 13:37270959-37270981 CCCTCATAACAAAGGATTATCTG No data
Right 1107164725 13:37270983-37271005 CCCCAGTGTCAATAGTGCTGTGG No data
1107164720_1107164725 2 Left 1107164720 13:37270958-37270980 CCCCTCATAACAAAGGATTATCT No data
Right 1107164725 13:37270983-37271005 CCCCAGTGTCAATAGTGCTGTGG No data
1107164722_1107164725 0 Left 1107164722 13:37270960-37270982 CCTCATAACAAAGGATTATCTGG No data
Right 1107164725 13:37270983-37271005 CCCCAGTGTCAATAGTGCTGTGG No data
1107164718_1107164725 20 Left 1107164718 13:37270940-37270962 CCTAGAATGTGAGGACAGCCCCT No data
Right 1107164725 13:37270983-37271005 CCCCAGTGTCAATAGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107164725 Original CRISPR CCCCAGTGTCAATAGTGCTG TGG Intergenic