ID: 1107171529

View in Genome Browser
Species Human (GRCh38)
Location 13:37347929-37347951
Sequence ACAAAGAGCTTTGTAAGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107171529_1107171531 24 Left 1107171529 13:37347929-37347951 CCACAACTTACAAAGCTCTTTGT No data
Right 1107171531 13:37347976-37347998 CTTTTGCTGTCACTCTCATTGGG No data
1107171529_1107171530 23 Left 1107171529 13:37347929-37347951 CCACAACTTACAAAGCTCTTTGT No data
Right 1107171530 13:37347975-37347997 ACTTTTGCTGTCACTCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107171529 Original CRISPR ACAAAGAGCTTTGTAAGTTG TGG (reversed) Intergenic