ID: 1107174804

View in Genome Browser
Species Human (GRCh38)
Location 13:37387985-37388007
Sequence ATGCTGTTTGAAGTGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107174804_1107174813 28 Left 1107174804 13:37387985-37388007 CCCTTTCCCACTTCAAACAGCAT No data
Right 1107174813 13:37388036-37388058 ATGTTTGGATGTGTCTTTTTTGG No data
1107174804_1107174809 -9 Left 1107174804 13:37387985-37388007 CCCTTTCCCACTTCAAACAGCAT No data
Right 1107174809 13:37387999-37388021 AAACAGCATTGGTACCTATTTGG No data
1107174804_1107174811 13 Left 1107174804 13:37387985-37388007 CCCTTTCCCACTTCAAACAGCAT No data
Right 1107174811 13:37388021-37388043 GAGTCTCCAAGTTAAATGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107174804 Original CRISPR ATGCTGTTTGAAGTGGGAAA GGG (reversed) Intergenic
No off target data available for this crispr