ID: 1107177246

View in Genome Browser
Species Human (GRCh38)
Location 13:37413375-37413397
Sequence GGATACTGCCTGGGCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107177246_1107177250 -1 Left 1107177246 13:37413375-37413397 CCTGTTTTGCCCAGGCAGTATCC No data
Right 1107177250 13:37413397-37413419 CATTGCCCTGTTCTTATCTCCGG No data
1107177246_1107177253 5 Left 1107177246 13:37413375-37413397 CCTGTTTTGCCCAGGCAGTATCC No data
Right 1107177253 13:37413403-37413425 CCTGTTCTTATCTCCGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107177246 Original CRISPR GGATACTGCCTGGGCAAAAC AGG (reversed) Intergenic
No off target data available for this crispr