ID: 1107177376

View in Genome Browser
Species Human (GRCh38)
Location 13:37414853-37414875
Sequence GGGGCATGACCTCATCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107177376_1107177388 30 Left 1107177376 13:37414853-37414875 CCACCTGGATGAGGTCATGCCCC No data
Right 1107177388 13:37414906-37414928 TGTGAAGGGGTCCAAAGGCCTGG No data
1107177376_1107177384 15 Left 1107177376 13:37414853-37414875 CCACCTGGATGAGGTCATGCCCC No data
Right 1107177384 13:37414891-37414913 GCATTCAATGACTGTTGTGAAGG No data
1107177376_1107177385 16 Left 1107177376 13:37414853-37414875 CCACCTGGATGAGGTCATGCCCC No data
Right 1107177385 13:37414892-37414914 CATTCAATGACTGTTGTGAAGGG No data
1107177376_1107177387 25 Left 1107177376 13:37414853-37414875 CCACCTGGATGAGGTCATGCCCC No data
Right 1107177387 13:37414901-37414923 ACTGTTGTGAAGGGGTCCAAAGG No data
1107177376_1107177386 17 Left 1107177376 13:37414853-37414875 CCACCTGGATGAGGTCATGCCCC No data
Right 1107177386 13:37414893-37414915 ATTCAATGACTGTTGTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107177376 Original CRISPR GGGGCATGACCTCATCCAGG TGG (reversed) Intergenic
No off target data available for this crispr