ID: 1107177387

View in Genome Browser
Species Human (GRCh38)
Location 13:37414901-37414923
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107177380_1107177387 6 Left 1107177380 13:37414872-37414894 CCCCCTTCTGGGACAAACTGCAT No data
Right 1107177387 13:37414901-37414923 ACTGTTGTGAAGGGGTCCAAAGG No data
1107177377_1107177387 22 Left 1107177377 13:37414856-37414878 CCTGGATGAGGTCATGCCCCCTT No data
Right 1107177387 13:37414901-37414923 ACTGTTGTGAAGGGGTCCAAAGG No data
1107177383_1107177387 3 Left 1107177383 13:37414875-37414897 CCTTCTGGGACAAACTGCATTCA No data
Right 1107177387 13:37414901-37414923 ACTGTTGTGAAGGGGTCCAAAGG No data
1107177376_1107177387 25 Left 1107177376 13:37414853-37414875 CCACCTGGATGAGGTCATGCCCC No data
Right 1107177387 13:37414901-37414923 ACTGTTGTGAAGGGGTCCAAAGG No data
1107177382_1107177387 4 Left 1107177382 13:37414874-37414896 CCCTTCTGGGACAAACTGCATTC No data
Right 1107177387 13:37414901-37414923 ACTGTTGTGAAGGGGTCCAAAGG No data
1107177381_1107177387 5 Left 1107177381 13:37414873-37414895 CCCCTTCTGGGACAAACTGCATT No data
Right 1107177387 13:37414901-37414923 ACTGTTGTGAAGGGGTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107177387 Original CRISPR ACTGTTGTGAAGGGGTCCAA AGG Intergenic
No off target data available for this crispr