ID: 1107177495

View in Genome Browser
Species Human (GRCh38)
Location 13:37416084-37416106
Sequence AGCAAAAAGCCTTCCTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107177495_1107177507 27 Left 1107177495 13:37416084-37416106 CCTTTCCAGGAAGGCTTTTTGCT No data
Right 1107177507 13:37416134-37416156 GGATGGGACAAGGGTAGGAAAGG No data
1107177495_1107177503 11 Left 1107177495 13:37416084-37416106 CCTTTCCAGGAAGGCTTTTTGCT No data
Right 1107177503 13:37416118-37416140 TTACTCTGAAGAATGGGGATGGG No data
1107177495_1107177505 18 Left 1107177495 13:37416084-37416106 CCTTTCCAGGAAGGCTTTTTGCT No data
Right 1107177505 13:37416125-37416147 GAAGAATGGGGATGGGACAAGGG No data
1107177495_1107177506 22 Left 1107177495 13:37416084-37416106 CCTTTCCAGGAAGGCTTTTTGCT No data
Right 1107177506 13:37416129-37416151 AATGGGGATGGGACAAGGGTAGG No data
1107177495_1107177500 5 Left 1107177495 13:37416084-37416106 CCTTTCCAGGAAGGCTTTTTGCT No data
Right 1107177500 13:37416112-37416134 TTTCTGTTACTCTGAAGAATGGG No data
1107177495_1107177504 17 Left 1107177495 13:37416084-37416106 CCTTTCCAGGAAGGCTTTTTGCT No data
Right 1107177504 13:37416124-37416146 TGAAGAATGGGGATGGGACAAGG No data
1107177495_1107177499 4 Left 1107177495 13:37416084-37416106 CCTTTCCAGGAAGGCTTTTTGCT No data
Right 1107177499 13:37416111-37416133 GTTTCTGTTACTCTGAAGAATGG No data
1107177495_1107177502 10 Left 1107177495 13:37416084-37416106 CCTTTCCAGGAAGGCTTTTTGCT No data
Right 1107177502 13:37416117-37416139 GTTACTCTGAAGAATGGGGATGG No data
1107177495_1107177508 28 Left 1107177495 13:37416084-37416106 CCTTTCCAGGAAGGCTTTTTGCT No data
Right 1107177508 13:37416135-37416157 GATGGGACAAGGGTAGGAAAGGG No data
1107177495_1107177501 6 Left 1107177495 13:37416084-37416106 CCTTTCCAGGAAGGCTTTTTGCT No data
Right 1107177501 13:37416113-37416135 TTCTGTTACTCTGAAGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107177495 Original CRISPR AGCAAAAAGCCTTCCTGGAA AGG (reversed) Intergenic
No off target data available for this crispr