ID: 1107178357

View in Genome Browser
Species Human (GRCh38)
Location 13:37426152-37426174
Sequence TATGTTGGTGCTCCAGCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107178357_1107178359 0 Left 1107178357 13:37426152-37426174 CCTAATGCTGGAGCACCAACATA No data
Right 1107178359 13:37426175-37426197 TATAAAGAAAATATTATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107178357 Original CRISPR TATGTTGGTGCTCCAGCATT AGG (reversed) Intergenic
No off target data available for this crispr