ID: 1107181912

View in Genome Browser
Species Human (GRCh38)
Location 13:37471364-37471386
Sequence CAGGTTCAGCAGGCCCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107181912_1107181918 -5 Left 1107181912 13:37471364-37471386 CCCTACTGGGCCTGCTGAACCTG No data
Right 1107181918 13:37471382-37471404 ACCTGTGATAGGTGAGTGGGAGG No data
1107181912_1107181916 -9 Left 1107181912 13:37471364-37471386 CCCTACTGGGCCTGCTGAACCTG No data
Right 1107181916 13:37471378-37471400 CTGAACCTGTGATAGGTGAGTGG No data
1107181912_1107181917 -8 Left 1107181912 13:37471364-37471386 CCCTACTGGGCCTGCTGAACCTG No data
Right 1107181917 13:37471379-37471401 TGAACCTGTGATAGGTGAGTGGG No data
1107181912_1107181920 1 Left 1107181912 13:37471364-37471386 CCCTACTGGGCCTGCTGAACCTG No data
Right 1107181920 13:37471388-37471410 GATAGGTGAGTGGGAGGAAGCGG No data
1107181912_1107181921 22 Left 1107181912 13:37471364-37471386 CCCTACTGGGCCTGCTGAACCTG No data
Right 1107181921 13:37471409-37471431 GGTTTTCTCATTGCTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107181912 Original CRISPR CAGGTTCAGCAGGCCCAGTA GGG (reversed) Intergenic
No off target data available for this crispr