ID: 1107185440

View in Genome Browser
Species Human (GRCh38)
Location 13:37513765-37513787
Sequence GGGTCTAGACTTTCCACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107185437_1107185440 -2 Left 1107185437 13:37513744-37513766 CCTTACACTTTCTGCATGGCAGG No data
Right 1107185440 13:37513765-37513787 GGGTCTAGACTTTCCACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107185440 Original CRISPR GGGTCTAGACTTTCCACATC TGG Intergenic
No off target data available for this crispr