ID: 1107187276

View in Genome Browser
Species Human (GRCh38)
Location 13:37538406-37538428
Sequence TCAGCTCTAAAATGTTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107187276_1107187277 23 Left 1107187276 13:37538406-37538428 CCATTAAAACATTTTAGAGCTGA No data
Right 1107187277 13:37538452-37538474 ATGAGCTTTTTAGATCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107187276 Original CRISPR TCAGCTCTAAAATGTTTTAA TGG (reversed) Intergenic
No off target data available for this crispr