ID: 1107188069

View in Genome Browser
Species Human (GRCh38)
Location 13:37547257-37547279
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107188069_1107188073 -9 Left 1107188069 13:37547257-37547279 CCTCTCCCTAATCACTACTCAAG No data
Right 1107188073 13:37547271-37547293 CTACTCAAGCCTGAAGGCTATGG No data
1107188069_1107188080 23 Left 1107188069 13:37547257-37547279 CCTCTCCCTAATCACTACTCAAG No data
Right 1107188080 13:37547303-37547325 CTGCAAGACAGCAAAAATGCTGG No data
1107188069_1107188074 -6 Left 1107188069 13:37547257-37547279 CCTCTCCCTAATCACTACTCAAG No data
Right 1107188074 13:37547274-37547296 CTCAAGCCTGAAGGCTATGGAGG No data
1107188069_1107188079 0 Left 1107188069 13:37547257-37547279 CCTCTCCCTAATCACTACTCAAG No data
Right 1107188079 13:37547280-37547302 CCTGAAGGCTATGGAGGCGGGGG No data
1107188069_1107188075 -3 Left 1107188069 13:37547257-37547279 CCTCTCCCTAATCACTACTCAAG No data
Right 1107188075 13:37547277-37547299 AAGCCTGAAGGCTATGGAGGCGG No data
1107188069_1107188077 -1 Left 1107188069 13:37547257-37547279 CCTCTCCCTAATCACTACTCAAG No data
Right 1107188077 13:37547279-37547301 GCCTGAAGGCTATGGAGGCGGGG No data
1107188069_1107188076 -2 Left 1107188069 13:37547257-37547279 CCTCTCCCTAATCACTACTCAAG No data
Right 1107188076 13:37547278-37547300 AGCCTGAAGGCTATGGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107188069 Original CRISPR CTTGAGTAGTGATTAGGGAG AGG (reversed) Intergenic
No off target data available for this crispr