ID: 1107188074

View in Genome Browser
Species Human (GRCh38)
Location 13:37547274-37547296
Sequence CTCAAGCCTGAAGGCTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107188068_1107188074 -1 Left 1107188068 13:37547252-37547274 CCGCGCCTCTCCCTAATCACTAC No data
Right 1107188074 13:37547274-37547296 CTCAAGCCTGAAGGCTATGGAGG No data
1107188069_1107188074 -6 Left 1107188069 13:37547257-37547279 CCTCTCCCTAATCACTACTCAAG No data
Right 1107188074 13:37547274-37547296 CTCAAGCCTGAAGGCTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107188074 Original CRISPR CTCAAGCCTGAAGGCTATGG AGG Intergenic
No off target data available for this crispr