ID: 1107189144

View in Genome Browser
Species Human (GRCh38)
Location 13:37558973-37558995
Sequence CTGTCTGTCTGCCGCTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107189144 Original CRISPR CTGTCTGTCTGCCGCTCAGA AGG Intergenic
900140051 1:1136060-1136082 CATTCTGTCTGCAGCTCACAGGG + Intergenic
900310590 1:2031494-2031516 CTGCCTGTCAGCTGCTCTGACGG - Intergenic
900317530 1:2066366-2066388 CTCTCTGTCTGTCTCTCTGATGG + Intronic
901154500 1:7126282-7126304 CTGCCTGTCTTCACCTCAGATGG + Intronic
901954430 1:12773845-12773867 CTGGCTGGCTGCAGATCAGATGG - Intergenic
901956752 1:12791503-12791525 CTGGCTGGCTGCTGATCAGATGG - Intronic
901964735 1:12857176-12857198 CTGGCTGGCTGCTGATCAGATGG - Intronic
901972157 1:12916716-12916738 CTGGCTGGCTGCAGATCAGATGG - Intronic
901980136 1:13027650-13027672 CTGGCTGGCTGCTGATCAGATGG - Intronic
902001948 1:13201281-13201303 CTGGCTGGCTGCTGATCAGATGG + Intergenic
902013021 1:13285046-13285068 CTGGCTGGCTGCAGATCAGATGG + Intronic
902021171 1:13347006-13347028 CTGGCTGGCTGCTGATCAGATGG + Intronic
902029802 1:13413838-13413860 CTGGCTGACTGCAGATCAGATGG - Intronic
903576452 1:24342467-24342489 CTGTCTGTCCGCCTCTCTCATGG + Intronic
904876447 1:33658173-33658195 CTGGGTGTCTGCCACTCAGGAGG + Intronic
905665726 1:39761887-39761909 CTGTCTGTTTGCTGCCCAGCAGG + Intronic
911274496 1:95844470-95844492 CTGGGTGTTTGCCACTCAGAGGG - Intergenic
911378870 1:97087311-97087333 CTGTCTGCCTTCTGCTCAGAGGG - Intronic
911409104 1:97479383-97479405 CTGTCTGTCTCCCTCTCCAAGGG - Intronic
912762180 1:112378598-112378620 CTGCCTGTCAGCTGCTCAGGTGG + Intergenic
915193696 1:154173299-154173321 CTCTCTGTCTGCCCCTCAAATGG + Intronic
919429175 1:197471511-197471533 CTGTCGGCCTGCTGCTCAGAGGG + Intronic
920563881 1:206958668-206958690 CTGTGTCTCTGCAGCTCAGGAGG - Exonic
923794557 1:237141659-237141681 CTGTCCCGCTGCCGCCCAGAAGG - Intronic
1064655150 10:17549297-17549319 CTTGCTGTCTCCAGCTCAGAGGG - Intergenic
1067120909 10:43471409-43471431 CTGTGTGTTTGCAGCTCAGTTGG + Intronic
1067577827 10:47419215-47419237 CTGTCTGTCTGCAGCTCTCTGGG - Intergenic
1069884618 10:71615870-71615892 CTGTGTGCCTCCCGCTGAGAGGG - Intronic
1069959323 10:72070331-72070353 GCCTCTGTCTGCGGCTCAGATGG - Exonic
1071178151 10:82951641-82951663 CAGTCTGTGTGCCACACAGAGGG + Intronic
1071875117 10:89836806-89836828 CTTCCTGTCTTCAGCTCAGAGGG - Intergenic
1073123175 10:101134119-101134141 CTGTCTGTCTCCCGCTCCAGTGG + Intronic
1075718192 10:124569165-124569187 CTGTCTTTCTTCTGCCCAGAGGG + Intronic
1076344470 10:129771074-129771096 CTGTCTGTCTGTCTGTCTGAAGG + Intergenic
1080900477 11:36485481-36485503 CTTACTGTCTGCAGCTCTGAAGG - Intergenic
1080934137 11:36844054-36844076 CTGGCTGTTTGCCTCCCAGAAGG - Intergenic
1085745174 11:79108975-79108997 TTTTCTCTCTGCCGCCCAGAAGG + Intronic
1086737365 11:90322906-90322928 CTGTCTGTCTGCTGTTCTGCTGG + Intergenic
1089137264 11:116259647-116259669 CTGTGTGGCTGCTGCTTAGAAGG + Intergenic
1092086728 12:5768776-5768798 CTGGCTGTCTGCCCCTGAGCTGG + Intronic
1092088266 12:5783677-5783699 CTGTTTGGCTGTCACTCAGAAGG + Intronic
1095871496 12:47033282-47033304 GTTTCTGTCTGCCGCTCTGCAGG + Intergenic
1096252160 12:50040288-50040310 CTGTCTGTCTGTCTCTCCCAAGG - Intergenic
1098769942 12:74539603-74539625 CTTTCTGTCTGCCGCTCGAAAGG + Exonic
1100505604 12:95217473-95217495 CTGTCAGCCTGCCGCTCTGCGGG - Intronic
1100776927 12:97985278-97985300 CTGACCGTCTGCAGCTCTGATGG + Intergenic
1101660402 12:106760051-106760073 CTGTCTGTCTCCCTCACAGGAGG + Intronic
1101724320 12:107376501-107376523 GTGTCTGGCTGCAGTTCAGAAGG + Intronic
1101724804 12:107379951-107379973 GTGTCTGGCTGCAGTTCAGAAGG + Intronic
1102250618 12:111384569-111384591 CTGTTTGTCTCCAGATCAGATGG - Intergenic
1107189144 13:37558973-37558995 CTGTCTGTCTGCCGCTCAGAAGG + Intergenic
1107606044 13:42058091-42058113 CTATGTGTATGCCCCTCAGAAGG + Intronic
1108204024 13:48070638-48070660 ATCTCTGGCTGCAGCTCAGAAGG + Intronic
1109346139 13:61116876-61116898 ATCTCTGACTGCAGCTCAGAAGG + Intergenic
1113119246 13:106908707-106908729 ACTTCTGTCTGCAGCTCAGAAGG - Intergenic
1113925926 13:113941650-113941672 CTGTTTCTCTGCCTGTCAGATGG + Intergenic
1117586944 14:57217598-57217620 CTGTCTCTCTGCCTCTCCGTGGG + Intronic
1118333926 14:64835669-64835691 CTGTCGCTCTGCTGCTCAGGAGG + Intronic
1119437714 14:74609078-74609100 CTGGCTGTCTGCAGCTCACAAGG + Intronic
1121271628 14:92641633-92641655 CTCTCTGGCTCCCACTCAGAAGG - Intronic
1121729038 14:96173689-96173711 CTGTGTAGCTGCAGCTCAGAGGG + Intergenic
1122072327 14:99212774-99212796 CAGTCTTTCTGCCTCTCACATGG - Intronic
1122284328 14:100641883-100641905 GTGTCTGTCTGCAGCACTGAGGG - Intergenic
1122548024 14:102535506-102535528 CTCCCTGCCTGCCCCTCAGAGGG - Intergenic
1122781946 14:104147445-104147467 CTGTGGGTCTGCAGCTCTGAAGG - Intronic
1123057193 14:105576092-105576114 CTGTCTCTCTGCCTCTCTGAAGG + Intergenic
1123081052 14:105695799-105695821 CTGTCTCTCTGCCTCTCTGAAGG - Intergenic
1123105151 14:105837815-105837837 CTGTCTGTCTGCCCCACTCAGGG - Intergenic
1125062403 15:35440097-35440119 ATCTCTGGCTGCAGCTCAGAAGG + Intronic
1125605092 15:40935607-40935629 CTGCCTGCCTGCCTCACAGAGGG - Intronic
1125678672 15:41516879-41516901 CTGTCTGTCTGTCGGTCGGTCGG - Intergenic
1126435698 15:48635243-48635265 CTTTCTCTCTTCCGCTCTGAGGG + Intronic
1128319871 15:66685606-66685628 CTGTCTGTCTGCAGCTCTGGAGG - Exonic
1128389382 15:67172969-67172991 TTGTCTGCCTGCCGTTCAGGTGG + Intronic
1130053542 15:80503670-80503692 CTGTCTGTCTCCTTCACAGACGG - Intronic
1130208157 15:81897641-81897663 CTGTTTGTCTGCTACTAAGAAGG + Intergenic
1130542250 15:84828626-84828648 TTCTCAGTCTGCAGCTCAGAGGG - Intronic
1130669288 15:85897545-85897567 CTCTCTGTCTCTCTCTCAGATGG + Intergenic
1131518046 15:93092358-93092380 CAGTCAGACTGCAGCTCAGAGGG + Intergenic
1133686454 16:8169821-8169843 CTGTTTTTCTGCCTCCCAGATGG - Intergenic
1136172243 16:28496187-28496209 CTGTCTGTCTGACTCCCAGCAGG - Exonic
1138351885 16:56350424-56350446 CTGTCTCTCAGCAGCACAGAGGG - Intronic
1139295330 16:65895535-65895557 CTGCCTTTCTGCAGCGCAGAGGG - Intergenic
1140643339 16:77002663-77002685 GTGTTTGTCTGCCTCTCAGCAGG - Intergenic
1142495096 17:301993-302015 CTGACTTCCTCCCGCTCAGAGGG + Intronic
1143331341 17:6138064-6138086 CTGTCTTGCTGGTGCTCAGAAGG + Intergenic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146445230 17:32927946-32927968 CTCTCCGTCTGCCGCCCGGACGG + Exonic
1148489527 17:48014185-48014207 TTGTCTGTCTGTCACTCAGAAGG + Intergenic
1148795622 17:50195329-50195351 CTGGCTGTCTGCCTCCCACAGGG - Exonic
1148960507 17:51388624-51388646 CAGTCTTTCTGCCTCTCTGAGGG + Intergenic
1149500178 17:57146609-57146631 CTCTCTGCCTGCTGCTCAGAAGG - Intergenic
1150582977 17:66492150-66492172 CTTTCTGTCTGCCTCTCATAGGG + Intronic
1157529852 18:48410694-48410716 ATGTCTGTCTGGAGCGCAGAGGG - Intronic
1157675068 18:49562557-49562579 CTGTCTCTCTGCTGGTCTGATGG + Intronic
1158844305 18:61425446-61425468 CTCTCTCACTGCCCCTCAGACGG + Intronic
1159431774 18:68362027-68362049 ATTTCTGGCTGCAGCTCAGAAGG + Intergenic
1159574318 18:70156917-70156939 CTGTCTGCCAGCCTCTCAAAGGG + Intronic
1160739764 19:680378-680400 CTGCAGGTCTGCGGCTCAGACGG + Exonic
1163404870 19:17116015-17116037 CTGTCTCTCTGCCCCACAGCTGG + Intronic
1165151356 19:33762347-33762369 CTGTCAGTCAGCCGGTCAGCTGG - Intronic
1165485074 19:36090539-36090561 CTGTCTGTCTGCTGCCCTGATGG + Intronic
926198515 2:10777672-10777694 CTGTCGGTCTGCCCCGCAGCAGG - Exonic
926980955 2:18567493-18567515 CTGTGTGTCTGCTGCAGAGAAGG - Intronic
927646076 2:24877775-24877797 CTCTCTGTCTGGTGGTCAGATGG - Intronic
928165765 2:28970763-28970785 CTGTCTGACTGTGGCTCCGAGGG + Intronic
928374025 2:30760584-30760606 CTGTCTGTGTCCCGCCTAGAGGG + Intronic
930150263 2:48052050-48052072 ATCTCTGGCTGCTGCTCAGATGG - Intergenic
932008470 2:67951746-67951768 CTCTCTCTCTGTCACTCAGATGG - Intergenic
932459696 2:71874234-71874256 CTCTTTGTCTTCCACTCAGAGGG + Intergenic
934197048 2:89846220-89846242 TTGTCTGTCAGCCACTCACAAGG + Intergenic
935748044 2:106206350-106206372 CTATCTGTCTGCAGCTCACCTGG - Intergenic
935861051 2:107329966-107329988 CTGTCTGTCTGCCAGTGTGAGGG + Intergenic
936065003 2:109324349-109324371 CTGCCTGGCAGCCCCTCAGAAGG - Intronic
937824102 2:126345705-126345727 CTTTCTGTCTGCCTGTCAGGTGG + Intergenic
938322374 2:130373693-130373715 CTGTCTGTCTGCCTATCTGGAGG - Exonic
946381755 2:219353520-219353542 CTGCCTGTCCGCTCCTCAGATGG + Intergenic
1173298890 20:41783015-41783037 CTGTCTGTGTGCTGCTTACATGG + Intergenic
1174037012 20:47674612-47674634 CTGTCTGTCTCCCGGTGACACGG - Intronic
1174170167 20:48612587-48612609 GTGTCTGTCAGCCCCTCTGAGGG + Intergenic
1175136691 20:56829493-56829515 CTGTCTCTATGGCGCTCACACGG - Intergenic
1175205596 20:57308855-57308877 CTGTCTGGCTGCCGTTCCCAGGG - Intergenic
1175379617 20:58553715-58553737 CTGTCTGTCAGGCACTCACAAGG + Intergenic
1175871290 20:62210662-62210684 CTGCCTGGCTGCAGCTCAGCAGG - Intergenic
1178350921 21:31872906-31872928 CTCCCTGTCTGGCGCTCAGGTGG + Intergenic
1178496235 21:33088814-33088836 CTGTATGTCTCCAGGTCAGACGG - Intergenic
1179797736 21:43795030-43795052 CTGTCTGTCAGCAGCTCTGGGGG + Intronic
1184193775 22:42912618-42912640 CTGTCTGTGTGTGGCTCAGCTGG + Intronic
1184331659 22:43831674-43831696 CTGTCTGGCTTCTGCGCAGATGG - Intronic
1184837521 22:47032677-47032699 CTGTCTGGCCGCTGCTCTGAAGG - Intronic
950495021 3:13328560-13328582 CTGTCTGTCTTCCTCTGAGCTGG + Intronic
952861790 3:37818872-37818894 CTTTCTTTCTGCCTTTCAGATGG + Exonic
953717705 3:45330091-45330113 CAGTCTGTCAGCCGGCCAGAAGG - Intergenic
953938622 3:47069822-47069844 TCCTCTGTCTGCCTCTCAGAGGG + Intronic
954039687 3:47875622-47875644 CTGTCTATCTGACACTCAGAGGG + Intronic
955080160 3:55650817-55650839 CTTTGTGTCTGCCTCTCATAGGG + Intronic
957146302 3:76428844-76428866 ATGACTGTCGGCAGCTCAGAAGG - Intronic
965715316 3:171596390-171596412 CTGGCTGTCTGCAGGTCAGGGGG - Intergenic
967487940 3:190056098-190056120 CTCTCTCTCTGCCTCTCACATGG + Intronic
968940325 4:3634312-3634334 CTGTCTGCTGGCCCCTCAGAGGG + Intergenic
969923125 4:10559523-10559545 CTGTGTGCCTGCCCCACAGAGGG + Intronic
970268444 4:14316045-14316067 CTGTCTTCCTTCCCCTCAGAGGG - Intergenic
970649888 4:18165771-18165793 CTGTCTTTCTGGCTTTCAGATGG + Intergenic
974409444 4:61520686-61520708 CTGTCTGTCTGTCTGTCTGAGGG + Intronic
979088499 4:116447572-116447594 CTGTCTGTCTGCCTGTCTCAAGG - Intergenic
985486810 5:156508-156530 CTGGCTGTGTGCAGCTGAGATGG - Intronic
986077831 5:4356594-4356616 CTGTCTGTCTGAAGCTACGAGGG - Intergenic
986649898 5:9953019-9953041 CTTTCTGTCTACCGCTTATAAGG + Intergenic
987364403 5:17136162-17136184 CTGTCTCTCTGCTGCCAAGATGG + Intronic
988845072 5:35119499-35119521 CTGGCTGTCTTATGCTCAGATGG - Intronic
989483610 5:41962318-41962340 CTGCTTGTCTGCATCTCAGAGGG + Intergenic
990508083 5:56464471-56464493 CTGTCTGACTGCCCCTCCCAGGG - Intronic
990774829 5:59294374-59294396 CTGTCTTTCTGCATCTCAAATGG + Intronic
990798320 5:59569824-59569846 CTGTTTGTCTGCAGCCCAAAAGG + Intronic
992487559 5:77210783-77210805 CTGTGTGTCCGCCGCTCCGTCGG - Intronic
992817446 5:80457995-80458017 CTGTTTCTCTGTCGCTCAGGCGG - Intronic
996559272 5:124811266-124811288 CTGTCTATCTTTTGCTCAGATGG + Intergenic
997338124 5:133122017-133122039 CTGTCTCCCTGCTGCTCAGGAGG - Intergenic
998536045 5:142931825-142931847 CTGTGTTTCTGCCTCTCTGAGGG + Intronic
999054320 5:148557484-148557506 ATGTGTGTCTGGAGCTCAGAGGG + Intronic
1005238183 6:23790793-23790815 CTGCCTGCCTGCTACTCAGAGGG + Intergenic
1005601752 6:27433078-27433100 ATGTCTGTCTGGTGCTCAGTTGG - Intergenic
1005943368 6:30578007-30578029 CTGTATTTCTGCCTCACAGAGGG - Intronic
1006370533 6:33641262-33641284 CTGTCTGTCTGACTGTCAGTCGG - Intronic
1007387972 6:41532146-41532168 CTGTCTGTCTGTCCCTGAGAGGG + Intergenic
1007971853 6:46059776-46059798 CTGCCAGTCTGCCTCCCAGAGGG + Intronic
1009576878 6:65475730-65475752 CTGTCTGTCTGTCTGTCAGGGGG - Intronic
1010541557 6:77098545-77098567 ATCTCTGACTGCAGCTCAGAAGG + Intergenic
1010870745 6:81035031-81035053 CTGTCTGCTTGGCTCTCAGATGG - Intergenic
1011827691 6:91330026-91330048 CTGTCTGTCTGTCTGTCAGGTGG + Intergenic
1012413267 6:98984366-98984388 CTGTCTGCCTGGCTCACAGATGG - Intergenic
1018313635 6:162535197-162535219 CGGTCTTTCTGCAGCTCAGAGGG + Intronic
1018909450 6:168093696-168093718 CTGTCCCTCAGCTGCTCAGAGGG - Intergenic
1019646105 7:2129846-2129868 CTGCCTGTGTGCCCCTCCGACGG - Intronic
1021129264 7:16891430-16891452 CTGTCTGTCTGCCGAGGAGGTGG + Intergenic
1021788179 7:24173344-24173366 TTGTCTGTCTGCCGTTCAAGAGG - Intergenic
1021807602 7:24372808-24372830 CTCTCTGTGTGTCTCTCAGATGG - Intergenic
1021815444 7:24443085-24443107 CTGTGTGTCTGGCCCTCACAAGG + Intergenic
1026103766 7:67404423-67404445 CAGTCTGTCTGCCTCTCTGCTGG - Intergenic
1030524401 7:110636077-110636099 CTCTCTGTCTTCCCCTTAGAAGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035407063 7:158606039-158606061 CACACTGTCTGCCCCTCAGAGGG + Intergenic
1036552878 8:9830616-9830638 ATGTCTGTCTGTCACTGAGAAGG + Intergenic
1036759950 8:11501412-11501434 CTGTCTGTCTGTCTATCTGATGG + Intronic
1042159852 8:65881690-65881712 CTCTCTGTGTGCTGCTCACATGG + Intergenic
1045810026 8:106210429-106210451 CTGTGTGTCGGCTGCTCAGTGGG - Intergenic
1047762613 8:127965384-127965406 CTCTCTGTCTGACGCTGTGAGGG - Intergenic
1052059515 9:23942990-23943012 ATCTCTGTCTACAGCTCAGAAGG - Intergenic
1054450431 9:65400985-65401007 CTGTCTACCGGCCCCTCAGAGGG - Intergenic
1055020069 9:71660137-71660159 CTGTCTGTCTCCAGCTTTGAGGG - Intergenic
1060911809 9:127357224-127357246 CTGTCTGTCTGACTCTCCCATGG + Exonic
1188615794 X:32157729-32157751 CTGGCTGTGAGCTGCTCAGAGGG - Intronic
1189520348 X:41760563-41760585 CTGTCTGTCTCCTGGTCAGTTGG - Intronic
1197133159 X:123029546-123029568 CTGTCTGTCTGCTGTTCACAAGG + Intergenic
1202047990 Y:20753329-20753351 CTGCCTGGCTGCCTCCCAGAGGG + Intergenic