ID: 1107189367

View in Genome Browser
Species Human (GRCh38)
Location 13:37560848-37560870
Sequence CTACATAAGGAGAAATGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107189362_1107189367 -3 Left 1107189362 13:37560828-37560850 CCTGTAAATTGCACCCTTCTCTA 0: 2
1: 8
2: 14
3: 30
4: 113
Right 1107189367 13:37560848-37560870 CTACATAAGGAGAAATGAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 195
1107189361_1107189367 -2 Left 1107189361 13:37560827-37560849 CCCTGTAAATTGCACCCTTCTCT 0: 2
1: 8
2: 14
3: 31
4: 202
Right 1107189367 13:37560848-37560870 CTACATAAGGAGAAATGAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107189367 Original CRISPR CTACATAAGGAGAAATGAGG AGG Intergenic
900735517 1:4297287-4297309 CGAGAAAAGGAGGAATGAGGAGG + Intergenic
902262258 1:15235481-15235503 CTACTTGAGGGGAAAGGAGGTGG + Intergenic
905506345 1:38482534-38482556 CTTCATTTGGAGAAGTGAGGTGG + Intergenic
906936008 1:50214625-50214647 GGATAGAAGGAGAAATGAGGGGG + Intergenic
906942348 1:50266182-50266204 CCAGATAAGGAGAGATGGGGAGG - Intergenic
908405197 1:63807644-63807666 CTACACAAGGAGACAAGATGGGG - Intronic
908423675 1:63984162-63984184 CTAAATAAGGAAGAATGAGAAGG + Intronic
909364409 1:74802612-74802634 CTACATAATCAGAAAGGAGAGGG - Intergenic
911354074 1:96794771-96794793 CAACAAAAGGAGAAATTGGGAGG + Intronic
911680067 1:100705021-100705043 CAATAAAAGGAGAGATGAGGTGG - Intergenic
913968200 1:143394145-143394167 CTAAATAAGAAGAGGTGAGGAGG + Intergenic
914062579 1:144219737-144219759 CTAAATAAGAAGAGGTGAGGAGG + Intergenic
914116571 1:144746617-144746639 CTAAATAAGAAGAGGTGAGGAGG - Intergenic
916229315 1:162524148-162524170 AAACATAAGGAAATATGAGGAGG - Exonic
916945233 1:169719587-169719609 ATAAATAAGGAGAAACCAGGTGG - Intronic
918295664 1:183154000-183154022 CTAAATAACTAGAAAAGAGGGGG - Intergenic
919940731 1:202284199-202284221 CTACATCAGGAGAAATGTCCTGG - Intronic
920015955 1:202908626-202908648 CCACATAAGGGGAAGTGAAGAGG + Intronic
920694277 1:208170060-208170082 CTGCATATGGGGAAATGAAGGGG - Intronic
921977301 1:221217156-221217178 TCACATAAGGAGCAATGAAGTGG - Intergenic
924079303 1:240377188-240377210 CTACATAATGAGAAATGTTAAGG - Intronic
924120537 1:240793425-240793447 CTACAAAATGACAAATGAGATGG + Intronic
1064698648 10:17993963-17993985 CTTCCTCAGTAGAAATGAGGAGG + Intronic
1064762596 10:18636570-18636592 TTCCATTATGAGAAATGAGGAGG - Intronic
1064762854 10:18639170-18639192 TTCCATTATGAGAAATGAGGAGG - Intronic
1065253777 10:23844124-23844146 CTTTATAAGTGGAAATGAGGGGG - Intronic
1065267643 10:23993996-23994018 CTGCATCAGGAGAAATGCGAAGG - Intronic
1070867034 10:79712871-79712893 CTACATCAGGAGGAAAGAGTGGG - Intronic
1070880824 10:79850992-79851014 CTACATCAGGAGGAAAGAGTGGG - Intergenic
1071224729 10:83515637-83515659 CTACATAATGAGATATCATGGGG - Intergenic
1071441620 10:85702964-85702986 AGACAGAAGGAGAAAGGAGGAGG + Intronic
1071472288 10:85992150-85992172 CTAAATAAGGAGGGAGGAGGAGG + Intronic
1072062359 10:91826091-91826113 CTACATAATGAGAAATCTTGAGG + Intronic
1073784068 10:106868981-106869003 ATACAAAATGAGAAATGATGAGG + Intronic
1074295843 10:112188291-112188313 ATTCATAAGGAAAAAAGAGGAGG + Intronic
1074846961 10:117406899-117406921 CTACATGAGGAGGAATGGAGGGG + Intergenic
1075737416 10:124672485-124672507 CTTCATTAGGAGAATCGAGGAGG + Intronic
1075791151 10:125085145-125085167 CATCAGCAGGAGAAATGAGGCGG + Intronic
1077723038 11:4646421-4646443 CTTCTTAAGGAGACATGGGGAGG + Intronic
1079006194 11:16793108-16793130 CTACAAAAGGGAAAATGAGGAGG + Intronic
1079270758 11:18983571-18983593 CTACATAAGAAGAAGCAAGGAGG + Intergenic
1079754454 11:24239176-24239198 CTCTAAAAGGAGAAATGAAGAGG - Intergenic
1081236010 11:40647919-40647941 TTACAAAAGGAGAAAGCAGGGGG - Intronic
1081628374 11:44669910-44669932 TTACAAATGGGGAAATGAGGAGG + Intergenic
1083007872 11:59365614-59365636 CTACATCAGGATAAATAATGTGG + Intergenic
1084982528 11:72838315-72838337 CTACATAAGGAAACAGAAGGAGG - Exonic
1085486364 11:76866887-76866909 CTACATAAAGGGAAATGGAGGGG + Intronic
1087529894 11:99366705-99366727 CTACATTGACAGAAATGAGGCGG + Intronic
1088364153 11:109021242-109021264 CAACACAAGAAGAAATGAGGAGG - Intergenic
1089895331 11:121925019-121925041 AAAAATAAGGAGAAATAAGGTGG - Intergenic
1091034088 11:132217704-132217726 GTAGAAAAGGAGAACTGAGGTGG - Intronic
1091149565 11:133315055-133315077 CTAAATAAGGTAAAATGAGGAGG + Intronic
1094272960 12:28637661-28637683 GTATATAGGGAGAAATGAGGAGG + Intergenic
1096822600 12:54248685-54248707 CTACATAGGGAGGGAAGAGGAGG + Intronic
1097339174 12:58417937-58417959 CTATATAAGGATAAATAAAGAGG - Intergenic
1097810088 12:64009710-64009732 CTAGAAAAGGAGAAATTAGAAGG - Intronic
1098713320 12:73796205-73796227 ATACAAAAGTAGAAATGAAGTGG - Intergenic
1098975172 12:76895138-76895160 CTGCAAAAGGAGCAAGGAGGAGG + Intergenic
1104953274 12:132451856-132451878 CCAAATTAGGAGTAATGAGGGGG - Intergenic
1107189367 13:37560848-37560870 CTACATAAGGAGAAATGAGGAGG + Intergenic
1107347152 13:39473908-39473930 AAACAAAAAGAGAAATGAGGAGG + Intronic
1108732510 13:53249272-53249294 CTAAAGAAGGAGAGATGAGATGG + Intergenic
1109014395 13:56991232-56991254 ATAGAGAAGGAGAAAGGAGGTGG + Intergenic
1114724659 14:24922706-24922728 CTGCATAAGGTGGAATGAGCAGG - Intronic
1115708826 14:36027628-36027650 CTACATAAGGGGAAAAGCAGGGG - Intergenic
1116925865 14:50636343-50636365 AAACAGAAGGAGAAATGAAGAGG + Intronic
1117311385 14:54526933-54526955 CTAAAAAGGGAGAAATGATGGGG - Intronic
1117390269 14:55256064-55256086 ATACATAAGGAGAAATGCACAGG - Intergenic
1119160392 14:72447391-72447413 GGACAGAAGGGGAAATGAGGAGG - Intronic
1120121668 14:80687576-80687598 CTACTCAAGGAGAAAGGAAGGGG + Intronic
1120152122 14:81048094-81048116 CTTCATAACAATAAATGAGGAGG + Intronic
1121439812 14:93941540-93941562 CTACACAAATAGAAATTAGGAGG - Intronic
1121892993 14:97615164-97615186 TTCCAGAAGGAGAAAAGAGGGGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124290236 15:28446026-28446048 CTACAAAACAAGAAATGGGGAGG - Intergenic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124733397 15:32220319-32220341 ATACATAAAAGGAAATGAGGTGG - Intergenic
1127900265 15:63335925-63335947 CTTCCCAAGGAGCAATGAGGAGG - Intronic
1129908001 15:79203302-79203324 CAACATATGGAAAAAGGAGGAGG + Intergenic
1129938205 15:79468789-79468811 CAACATAAGAAGAAAAGAGGTGG + Exonic
1130753133 15:86734683-86734705 TGACATCAGGAAAAATGAGGAGG + Intronic
1136708501 16:32211594-32211616 CTACAAAACAAGAAATGGGGAGG + Intergenic
1136759403 16:32717818-32717840 CTACAAAACAAGAAATGGGGAGG - Intergenic
1136808701 16:33152568-33152590 CTACAAAACAAGAAATGGGGAGG + Intergenic
1137644657 16:50063538-50063560 CAATATAAGGAGAAAGGTGGAGG + Intergenic
1203061559 16_KI270728v1_random:978127-978149 CTACAAAACAAGAAATGGGGAGG - Intergenic
1144192637 17:12860598-12860620 CTATATGAGGACAAATGAGAGGG - Intronic
1146895502 17:36538148-36538170 CTACGTAAAGAGATATGAAGAGG - Exonic
1149556492 17:57577101-57577123 TCGAATAAGGAGAAATGAGGTGG + Intronic
1154449622 18:14463348-14463370 CTACTAAAGCAGAAATTAGGAGG + Intergenic
1155990145 18:32271647-32271669 CTGCAGAAGGAGTAATGAAGCGG + Intronic
1156091787 18:33480184-33480206 CTAGATAAGAGGAAATTAGGGGG - Intergenic
1156345033 18:36249355-36249377 ATACAAAAGGGGAAATGAAGAGG - Intronic
1156722783 18:40090378-40090400 CAACATGAGGAGACATGAGGAGG + Intergenic
1159285729 18:66347779-66347801 CTACTTAACTAGAAATTAGGTGG + Intergenic
1165068904 19:33243977-33243999 CTACTTAAGGAGTAGTGTGGTGG - Intergenic
1202701987 1_KI270712v1_random:171609-171631 CTAAATAAGAAGAGGTGAGGAGG + Intergenic
925155013 2:1642371-1642393 TTACTTCAGGAAAAATGAGGTGG + Intronic
927300901 2:21513076-21513098 CTTCAAAAAGAAAAATGAGGAGG - Intergenic
931533342 2:63242854-63242876 CTACAAAAGGAGGAAAAAGGAGG - Intronic
934172899 2:89555059-89555081 CTAAATAAGAAGAGGTGAGGAGG + Intergenic
934196860 2:89844478-89844500 CTACATGTGGAGGAAAGAGGAGG - Intergenic
934283213 2:91629416-91629438 CTAAATAAGAAGAGGTGAGGAGG + Intergenic
935732417 2:106074925-106074947 CTACATAAAGTGAAATCATGTGG + Intronic
937642789 2:124232610-124232632 ACTCAAAAGGAGAAATGAGGAGG - Intronic
937981125 2:127616381-127616403 CTACGTAAGAAGAAGCGAGGAGG - Intronic
939071369 2:137548069-137548091 CGACATAAGATGAAATAAGGTGG + Intronic
940238139 2:151532625-151532647 TTATAGGAGGAGAAATGAGGAGG + Intronic
941226340 2:162854491-162854513 TTACATGTGGAGAAATGAGGTGG - Intergenic
942912165 2:181257436-181257458 ATAGATAAGCAGAAATGATGTGG - Intergenic
945034201 2:205690229-205690251 CTACAGAAAGGAAAATGAGGAGG + Intronic
945148426 2:206763034-206763056 CTAGATAAGGAGATCTGAGCTGG - Intronic
947267602 2:228300424-228300446 CTCCACAGGGAGAAATGAGGAGG - Intergenic
1168816712 20:742843-742865 CTACAGAGGGAGGAAGGAGGTGG - Intergenic
1173928887 20:46801802-46801824 CCACATAAGAAGAAATCTGGAGG - Intergenic
1174110638 20:48195575-48195597 CCACATGAGCAGAAGTGAGGAGG - Intergenic
1177675886 21:24297762-24297784 TTACATAAGAGGAAATTAGGCGG + Intergenic
1178490854 21:33050611-33050633 CTCCATAAGGAGAAGGAAGGAGG - Intergenic
1178688543 21:34731156-34731178 CTTCATAAGGGGAATGGAGGAGG + Intergenic
1179055040 21:37923591-37923613 CTAAATAAAGAGAAAATAGGAGG - Intergenic
1181003155 22:19997466-19997488 CTCCATGAGGAGACATGAGATGG + Intronic
951243892 3:20317747-20317769 CAACCTACGGGGAAATGAGGGGG - Intergenic
951630444 3:24714328-24714350 CGACATAATGAGAAATGGAGAGG + Intergenic
951688649 3:25372523-25372545 CTGCAGAAAGAGAAATGAGCTGG + Intronic
952526005 3:34211312-34211334 CTCCACAAGGAGGAAGGAGGGGG - Intergenic
953487417 3:43315121-43315143 CTGCCTAAGGAGAGATGAGCTGG + Intronic
953589379 3:44236865-44236887 CTGAATAAGGAGAAAGGAGGGGG - Intergenic
954033684 3:47838461-47838483 CTACCTAAGGTGAACTAAGGTGG - Intronic
956545637 3:70399139-70399161 CAGCAAAAGGAGAAAAGAGGAGG - Intergenic
957710727 3:83855756-83855778 CTACAAACCAAGAAATGAGGAGG - Intergenic
958081742 3:88754520-88754542 CTAGCAAAGGAGAAAGGAGGTGG - Intergenic
958457443 3:94349198-94349220 CTAAATATGGAGAAATGATCAGG - Intergenic
958569306 3:95859829-95859851 CTACGAAAGGAAAAATGAAGTGG - Intergenic
959887759 3:111521871-111521893 CAACATAAGAGGAAATGAGAGGG + Intronic
960190846 3:114703848-114703870 CTACATATAGACAAATGAGTTGG - Intronic
961215266 3:125154858-125154880 CTACGTGACGAGAAGTGAGGCGG + Intronic
964443855 3:156739973-156739995 ATACAGAAGGAGCAGTGAGGTGG + Intergenic
964686632 3:159403173-159403195 TTACAGAAGCAAAAATGAGGAGG + Intronic
965014621 3:163140741-163140763 CTACTTGAGGAGAAGAGAGGAGG - Intergenic
965946862 3:174253454-174253476 ATACATGAGGTGAAATGAGAGGG - Intronic
969483987 4:7461571-7461593 GGACATAATGAGAAATGAAGTGG + Intronic
969826748 4:9763915-9763937 CTAAATAAGAAGAGGTGAGGAGG + Intergenic
970820874 4:20211616-20211638 CTACAAAAGGAGAAAAAATGGGG - Intergenic
972981973 4:44715068-44715090 TTTCAAAAGGAGAACTGAGGTGG + Intronic
973062237 4:45741975-45741997 CTATATATGGGGAATTGAGGAGG + Intergenic
975265480 4:72360867-72360889 CTAAATAAGGAAAAATAGGGAGG - Intronic
976124481 4:81818967-81818989 CTTCTAAAGGAGAGATGAGGAGG + Intronic
976797021 4:88945460-88945482 CTACATATGGAAAAATTAAGAGG - Intronic
981646791 4:147007799-147007821 CTACATAATGAGAATAGAGAAGG + Intergenic
983975533 4:173929202-173929224 CTGCATAAGGAGAAAGAAGGTGG - Intergenic
984871162 4:184326420-184326442 CTACTTAAGGAGAAGAGAAGTGG - Intergenic
985679653 5:1249290-1249312 GTGCAGAAGGAGAAGTGAGGCGG + Intergenic
986047865 5:4058344-4058366 ATACACAAGTAGAAATGAGTGGG + Intergenic
986309396 5:6541040-6541062 CTACAGCAGGATAAGTGAGGAGG + Intergenic
986981398 5:13451657-13451679 CTAAATGAGGAGAGATGAGAAGG - Intergenic
987692330 5:21283127-21283149 CCACATAAGAAGAAGCGAGGTGG - Intergenic
988703495 5:33699889-33699911 CTACACAAAGAGAACTGAAGAGG + Intronic
989189934 5:38660739-38660761 ATACAAAAGTAGAAATGAAGTGG - Intergenic
990623094 5:57581446-57581468 CTACAGAAGGAGTCATGTGGAGG + Intergenic
991748030 5:69766923-69766945 CCACATAAGAAGAAGCGAGGTGG + Intergenic
991799609 5:70346771-70346793 CCACATAAGAAGAAGCGAGGTGG + Intergenic
991828988 5:70663267-70663289 CCACATAAGAAGAAGCGAGGTGG - Intergenic
991891968 5:71346200-71346222 CCACATAAGAAGAAGCGAGGTGG + Intergenic
994856306 5:105124700-105124722 TTACAAAAAGAGAAATGATGAGG - Intergenic
995926744 5:117384031-117384053 GTACATACGAAGAAATGAGGAGG - Intergenic
997081353 5:130743025-130743047 TTACCTAGGGAGAAAAGAGGAGG - Intergenic
999819735 5:155214557-155214579 CTGCAAAAGGAGAAATATGGGGG - Intergenic
1004997475 6:21207668-21207690 TTACATAGGGAGAACTGAGGTGG - Intronic
1006200660 6:32287032-32287054 AGGCATGAGGAGAAATGAGGAGG + Intergenic
1008959490 6:57251650-57251672 ATACAGAAGGGGAAATGAGCTGG + Intergenic
1009543087 6:64990089-64990111 CTACCTACAGACAAATGAGGTGG + Intronic
1012686094 6:102251685-102251707 CTACTTAAGGAGAAATGTGATGG + Intergenic
1013499290 6:110731860-110731882 CTTCATAAAGACAAATGAGAAGG + Intronic
1013986188 6:116197105-116197127 CTACAAATGGAGAAAGGAGGTGG - Intronic
1014601071 6:123413000-123413022 TTACTTAAGGAGGAATGTGGTGG + Intronic
1014862591 6:126488131-126488153 CTACATTAGGAGAAATACGATGG - Intergenic
1015228991 6:130892096-130892118 GTACATTAGCAAAAATGAGGAGG + Intronic
1019332756 7:468855-468877 CTTCATTAGGAAAAAGGAGGAGG - Intergenic
1022589760 7:31650487-31650509 CTACATCAGGAGCAATGGGAAGG + Intronic
1022811347 7:33872001-33872023 CTACAGAAGGAGAAGTAAAGAGG - Intergenic
1024881971 7:54096816-54096838 CTAGACAAAGGGAAATGAGGGGG + Intergenic
1024985494 7:55190202-55190224 CTACTTAAGAGGAAATGAGCAGG - Intronic
1026079734 7:67207059-67207081 CTACACAAGGTGAATTGGGGTGG - Intronic
1027940337 7:84670544-84670566 CTACACAAGGAGAAAGTAAGAGG + Intergenic
1028086436 7:86643612-86643634 CTAGAGAAGGACCAATGAGGGGG + Intergenic
1028166773 7:87547235-87547257 ATACACAAGGAAAAATTAGGTGG + Intronic
1031043760 7:116864381-116864403 CTTCATAAAGAGGAATGAGGAGG + Intronic
1031076497 7:117218433-117218455 CTACAAAAGCAGAATTTAGGTGG + Intronic
1031536906 7:122945640-122945662 CTGCAGAGGGAGAAAAGAGGTGG - Intergenic
1032072175 7:128814940-128814962 CCAGATAAGCAGAAAGGAGGAGG + Intronic
1032684051 7:134212749-134212771 CTAGATAAGGGGAAGTGATGAGG + Intronic
1033714702 7:143988000-143988022 CTACATCAGGATAAAAGAGGGGG + Intergenic
1034369743 7:150584546-150584568 CTACATAAGAAGAAGTGAGGAGG + Intergenic
1035473000 7:159122319-159122341 CTACACAAACAGAACTGAGGTGG + Intronic
1036005597 8:4659000-4659022 ATACATAAAGGGAAATGAGAGGG + Intronic
1036797681 8:11768268-11768290 CTACAGAAAGAGAAACTAGGGGG + Intergenic
1037894697 8:22644106-22644128 CTTCATCAGGAAAAATCAGGAGG + Intronic
1039535792 8:38311213-38311235 CTATATAATGAGTAATCAGGGGG - Intronic
1039867885 8:41521600-41521622 CTTCATAAGAAGGAATGAGGGGG + Intergenic
1041403036 8:57464637-57464659 CTACATAAGAAGTAGTGAGGAGG + Intergenic
1041995083 8:64045217-64045239 CTTCATAAGGAGAGTTGAGGAGG + Intergenic
1043693020 8:83180839-83180861 TTACATAGGGAGCACTGAGGAGG - Intergenic
1045366184 8:101478242-101478264 CCACATAAGAAGAATCGAGGTGG - Intergenic
1046005776 8:108481732-108481754 ATACAAAAGGAGAAATTAAGAGG - Intronic
1049585896 8:143432240-143432262 CTACAGATGAAGAAATGAAGTGG + Intergenic
1049760737 8:144330997-144331019 CTACCTAAGGAGAAAGCTGGAGG - Exonic
1050009989 9:1175634-1175656 CAACATAAGGAGAAAAGGTGAGG - Intergenic
1055868182 9:80841092-80841114 AGGCATTAGGAGAAATGAGGGGG + Intergenic
1060962785 9:127692936-127692958 CTAGATAAGGAGAAACACGGTGG - Intronic
1061158477 9:128879675-128879697 GTCCAGAAGGAGAAATGATGAGG - Intronic
1185766865 X:2732679-2732701 GTACATAAGAAGAAAAGAGAAGG - Intronic
1188243859 X:27819109-27819131 CTACAGAGGGTGAAGTGAGGAGG - Intronic
1188423349 X:30015543-30015565 CAATATGAGGAGAAATGAGTTGG + Intergenic
1195239481 X:102937178-102937200 CGAAATAAAGTGAAATGAGGTGG - Intergenic
1196971757 X:121117112-121117134 TTACATAAGAAGCAATGAGGTGG + Intergenic