ID: 1107196540

View in Genome Browser
Species Human (GRCh38)
Location 13:37659311-37659333
Sequence CATCACAGGGGGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 1, 2: 3, 3: 60, 4: 456}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107196540_1107196549 9 Left 1107196540 13:37659311-37659333 CCTTCCTCTTTCCCCCTGTGATG 0: 1
1: 1
2: 3
3: 60
4: 456
Right 1107196549 13:37659343-37659365 CTTCACTCTTTTGCCATGAATGG 0: 1
1: 0
2: 4
3: 19
4: 262
1107196540_1107196551 22 Left 1107196540 13:37659311-37659333 CCTTCCTCTTTCCCCCTGTGATG 0: 1
1: 1
2: 3
3: 60
4: 456
Right 1107196551 13:37659356-37659378 CCATGAATGGAAGCTTCCTGAGG 0: 19
1: 544
2: 1686
3: 9216
4: 10372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107196540 Original CRISPR CATCACAGGGGGAAAGAGGA AGG (reversed) Intronic
901142638 1:7044811-7044833 AACCACAGGCGGGAAGAGGAGGG - Intronic
901198983 1:7456140-7456162 CATAACAGAGGGATGGAGGAAGG + Intronic
901233780 1:7656558-7656580 CATGACAGAGGAAAATAGGACGG + Intronic
901927029 1:12572826-12572848 CTTCAGTGGGGGAAAGAGGTTGG + Exonic
902410408 1:16208587-16208609 CATGGCAGGGGGATAGGGGAGGG - Intronic
903014524 1:20353442-20353464 TTACACAGGGAGAAAGAGGAAGG + Intronic
903654466 1:24940764-24940786 CATCACAGGTGGCAAGTGGTGGG - Intronic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904118093 1:28176939-28176961 CATGAGAGTGAGAAAGAGGAGGG + Exonic
904422705 1:30404474-30404496 CATGACAGGGGGAGTGGGGAAGG - Intergenic
905220273 1:36441361-36441383 CACCACAGGCACAAAGAGGAAGG + Intronic
905434669 1:37948306-37948328 CTTCACTTGGGGAAAGAGGAAGG - Intergenic
905474875 1:38219031-38219053 TATCACAGAGGGAAAGAAGCTGG - Intergenic
906564292 1:46787027-46787049 CAGCAGAGGGTGAAAGAGAAAGG + Intronic
906646769 1:47480919-47480941 CATCCCAGGGAGAGAGAGGCTGG - Intergenic
907058522 1:51396588-51396610 CATCACAAGGAGAAAGGGAAAGG + Intronic
908026458 1:59957191-59957213 GCTCACAGAGGGAAAGGGGATGG + Intergenic
908651478 1:66337570-66337592 AAGGACATGGGGAAAGAGGAGGG + Intronic
909183701 1:72457813-72457835 CATCAGAGAGAGAGAGAGGAAGG - Intergenic
909573664 1:77147348-77147370 CATATCAGGAGGAGAGAGGAGGG + Intronic
910434222 1:87188754-87188776 CAGCCCAGGGGTAAAGAGTAAGG - Intergenic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
911436457 1:97865531-97865553 AATCAGAGGGTGAAGGAGGATGG - Intronic
911612992 1:99977537-99977559 CATCTCAGAAGGAAGGAGGAAGG + Intronic
911621913 1:100074574-100074596 CATCTCGGGGGGAAAAAGAAAGG + Intronic
911675294 1:100651907-100651929 CACCACAGAAAGAAAGAGGATGG - Intergenic
912481476 1:109984994-109985016 CGCCAGAGGGGGAAAGAGGCGGG + Exonic
915238409 1:154502285-154502307 CACCGCAGGAGGAAAGAGCAGGG - Intronic
915488906 1:156240849-156240871 CACCAGAGGGGGAAAGGGGTTGG + Intronic
917440796 1:175067187-175067209 CATCTGAGGGCAAAAGAGGAAGG + Intergenic
917928759 1:179809608-179809630 CAGCACAGGGGCAGGGAGGAGGG + Intronic
918703575 1:187635477-187635499 AGTGACAGGGAGAAAGAGGATGG - Intergenic
918706534 1:187669435-187669457 CAGCACAGGAGAAAAGATGAAGG + Intergenic
920204470 1:204281726-204281748 CATCAAAGGGGGGATGAGCAAGG - Intronic
920724749 1:208423664-208423686 AATCACACAGGGAAAGAGGAAGG + Intergenic
920924502 1:210328959-210328981 CAGCTCCGGGGGAAAGAGGGTGG + Exonic
922897452 1:229111452-229111474 CATGACATGGGGAAGGATGAAGG + Intergenic
923773969 1:236961737-236961759 CATCACATGGTGACAGAGGAAGG - Intergenic
924436931 1:244049690-244049712 AAACACACGGGGAAAGAGGAAGG - Intronic
1063703404 10:8407794-8407816 CATCACACAGGGAAAGAAGGGGG - Intergenic
1064002529 10:11675357-11675379 CATCACAGGGGTGGTGAGGAAGG + Intergenic
1065826880 10:29580405-29580427 AATCAAAGAGGGAAATAGGATGG + Intronic
1065960769 10:30732439-30732461 CATTCCAGTGGGAATGAGGAAGG - Intergenic
1066499300 10:35974483-35974505 TCTCACAGGGAGGAAGAGGAAGG - Intergenic
1067023920 10:42827199-42827221 CACCTCATGGGGAAAGTGGAAGG - Intronic
1069737146 10:70664259-70664281 CATGACAGAGTGGAAGAGGAAGG + Intergenic
1070543834 10:77437279-77437301 CAAGACAGGGAGAAAAAGGAAGG + Intronic
1073952100 10:108821622-108821644 GATCACATGGTGAAAAAGGAAGG + Intergenic
1074169233 10:110917123-110917145 TGTCACAGGGGGAAAAAAGATGG + Intronic
1075425368 10:122337939-122337961 CCCCAGAAGGGGAAAGAGGAAGG - Intronic
1078719503 11:13871478-13871500 CATCACAGAGGGCAAGAGGGAGG - Intergenic
1078754490 11:14196171-14196193 CTTCTCAGGGGGAGAGAAGATGG + Intronic
1079365254 11:19803434-19803456 CATTTCAGTGGGAAAGTGGAAGG - Intronic
1079646974 11:22876901-22876923 GATTAGAGGGGGCAAGAGGAAGG - Intergenic
1080392395 11:31860561-31860583 CATCACAGTGGCAGAGGGGAAGG + Intronic
1080571345 11:33559720-33559742 CAACACAGGAGAAAAGGGGAGGG - Intronic
1080716789 11:34810343-34810365 CAGCGCAGGTGGAAAGATGATGG + Intergenic
1081206119 11:40277453-40277475 AAGAAGAGGGGGAAAGAGGAAGG + Intronic
1082768845 11:57189992-57190014 CATCACAGAAGGAGAGAGCAGGG - Exonic
1082873301 11:57963381-57963403 ATTCACAGGGAGAGAGAGGAAGG - Intergenic
1083730937 11:64652161-64652183 CACCAAGGGGGGAATGAGGAGGG + Intronic
1083796725 11:65021270-65021292 CACCACAGTGAGAAAGAGCAGGG + Intronic
1084253402 11:67921067-67921089 AGTGACAGGGGGCAAGAGGACGG - Intergenic
1085590012 11:77751476-77751498 CATCTCAAGGGGACAGAAGAAGG - Intronic
1085681192 11:78576665-78576687 CATCACATGGCAAAAGAGGAAGG - Intergenic
1086476087 11:87176273-87176295 CATCACATGGGGAGACAGGAAGG - Intronic
1086574039 11:88317580-88317602 AATCACAGGGGTACAGTGGATGG - Intronic
1087259501 11:95994566-95994588 TGTGACAGGGGGAAAGAGGCAGG + Intronic
1087599813 11:100299299-100299321 CTTCAAAGGGAGTAAGAGGAGGG - Exonic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088868492 11:113871626-113871648 AATGAAAGGGGGAAAAAGGAAGG + Intronic
1089690575 11:120184545-120184567 CAGCAGAGGAGGAAAGGGGAGGG - Intronic
1089829024 11:121308754-121308776 TGTCACAGGGGGAAAGAAGTGGG + Intergenic
1090354096 11:126128025-126128047 CAGCTCAGGTGGAGAGAGGAGGG - Intergenic
1090778249 11:129984066-129984088 AAGCCTAGGGGGAAAGAGGAGGG - Intronic
1091142660 11:133249273-133249295 CATCCCATGGTGAGAGAGGAAGG + Intronic
1092293484 12:7179901-7179923 CATCACATGGTGAAAGGGCAAGG + Intergenic
1092895677 12:13007978-13008000 CATCATAGGAGGAGAGAGGGAGG + Intergenic
1093160831 12:15744292-15744314 TCTCATAGGGTGAAAGAGGAAGG - Intronic
1093376940 12:18440705-18440727 GGTTACAGGGGGAAAGAGTAGGG + Intronic
1094516151 12:31129048-31129070 AACCACAGGGGAAAAAAGGAGGG + Intergenic
1094692690 12:32785506-32785528 GAACAAAGGGGGAAAAAGGAGGG + Intergenic
1094778242 12:33757831-33757853 GAGCCCAAGGGGAAAGAGGAGGG - Intergenic
1095327989 12:40921065-40921087 CATCACCTGGGGGAAGAGGAAGG + Intronic
1095705104 12:45228558-45228580 TATCACAGGAGAACAGAGGAGGG + Intronic
1095822398 12:46492675-46492697 CTTGAAATGGGGAAAGAGGAAGG + Intergenic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096545137 12:52333326-52333348 CATCAAAGGGGAATGGAGGATGG - Intergenic
1098424043 12:70339390-70339412 GATCACAGGGGAAAAGAGACGGG - Intronic
1099181029 12:79472868-79472890 AATTCCAGGGGAAAAGAGGATGG + Intergenic
1099906292 12:88775384-88775406 CAACACATGGGGAGAGAAGATGG - Intergenic
1100785519 12:98073916-98073938 CCTCACAGGGGCAAAGACCAGGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101782092 12:107845648-107845670 CCTCGCCGGGGGAAAAAGGAGGG + Intergenic
1101820590 12:108181203-108181225 CATCCCAGGGAGGAAGAGCAAGG - Intronic
1101965715 12:109280614-109280636 CAATCCAGGGGGAAAGAGGCAGG + Intronic
1103182415 12:118925167-118925189 CAGCACAGAGGTAAAGAGTATGG + Intergenic
1103550321 12:121732402-121732424 CATTTCAGGGGTAAAGGGGAGGG - Intronic
1103646460 12:122397226-122397248 CATCAGAAGGGCAAAGAGCATGG - Intronic
1103954964 12:124571006-124571028 CAACAGAGGGGGAAGGAGGCAGG + Intergenic
1105762929 13:23530209-23530231 CATCAAAAGGGGAAGGAGAAGGG + Intergenic
1106054895 13:26228957-26228979 CACCACAGTGGAAAAGATGAGGG - Intergenic
1106630192 13:31463648-31463670 AATAACAGGGGTAAAGAGAAAGG - Intergenic
1107196540 13:37659311-37659333 CATCACAGGGGGAAAGAGGAAGG - Intronic
1107453757 13:40535904-40535926 TATCACAGGTCCAAAGAGGAGGG + Intergenic
1107453907 13:40536950-40536972 CAACTCAGGGGCAAAGAGAAAGG + Intergenic
1107627224 13:42301491-42301513 GATCACAGTGGGAAAATGGAGGG - Exonic
1109647917 13:65284521-65284543 CAACACAGAGTGAAAGTGGAAGG + Intergenic
1109691191 13:65892023-65892045 AAACACAGGAGGAAAGAGGAAGG + Intergenic
1111694026 13:91600876-91600898 AATTATAGAGGGAAAGAGGAGGG - Intronic
1111736988 13:92154127-92154149 TATCACATGGAGAGAGAGGATGG + Intronic
1111772909 13:92622066-92622088 CATCCCACGGGCAAACAGGAAGG - Intronic
1112874789 13:104023954-104023976 CATCACATGGTGAAAGAGGGAGG + Intergenic
1113053911 13:106246399-106246421 AAGCACAGAGGGACAGAGGAAGG + Intergenic
1113113700 13:106851821-106851843 AATGACAGGGGGAAAGACAATGG - Intergenic
1113360778 13:109629384-109629406 AATCACAGGGGGAGAAAGGAAGG + Intergenic
1113631654 13:111892210-111892232 GCTCACAGGGTGACAGAGGAAGG - Intergenic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1113966015 13:114154692-114154714 CCTCAGTGGTGGAAAGAGGAGGG - Intergenic
1114909798 14:27176535-27176557 CCTCACATTGGGAGAGAGGAAGG + Intergenic
1115790403 14:36871258-36871280 CCTCACATGGTGAAAGAGCAAGG - Intronic
1115826516 14:37284260-37284282 CATCTCAGTGGGAAGGTGGAAGG - Intronic
1116654042 14:47628693-47628715 CATCTCAAGGGGAAATATGACGG + Intronic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1117240794 14:53830138-53830160 CATCCCTAGGGGAAAGGGGAGGG + Intergenic
1117833339 14:59776679-59776701 CATCAGAGAGGGTAAGGGGAAGG - Intronic
1118887651 14:69879837-69879859 CATCCCTGAGGGAAGGAGGAGGG + Intronic
1119323209 14:73743635-73743657 CCTCACAGTGAGGAAGAGGAAGG + Intronic
1120527144 14:85590318-85590340 CAGCACATGGGTTAAGAGGAAGG - Intronic
1122159146 14:99770108-99770130 GATCATAGGAGGACAGAGGAGGG - Intronic
1122186825 14:100005491-100005513 CATCAGAGGGTGCAAGAGAAAGG + Intronic
1122201267 14:100124045-100124067 TACCACAGTGGGGAAGAGGAAGG + Intronic
1122298748 14:100719978-100720000 GATCAGAGGTGGCAAGAGGACGG + Intergenic
1122420223 14:101571712-101571734 AAGCAGAGGGGGAAGGAGGAGGG + Intergenic
1123181328 14:106473234-106473256 GATCACAGGGGGTGAGTGGAGGG - Intergenic
1202945567 14_KI270726v1_random:23466-23488 GATCACAGGGGGTGAGTGGAGGG + Intergenic
1123425063 15:20164247-20164269 CATCTCATGGGGAAAGTGGAAGG - Intergenic
1123534288 15:21170780-21170802 CATCTCATGGGGAAAGTGGAAGG - Intergenic
1124656707 15:31515082-31515104 CAGCACAGGGGGAGAGAATATGG + Intronic
1127267428 15:57373637-57373659 CACCCAAGGGAGAAAGAGGAGGG - Intergenic
1128612440 15:69084760-69084782 GATTAGAGAGGGAAAGAGGAAGG - Intergenic
1128735303 15:70050318-70050340 CATCAGAGAGGGGCAGAGGAGGG - Intronic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1131949579 15:97666575-97666597 CAAATCAGGGGGAGAGAGGATGG - Intergenic
1132005920 15:98226825-98226847 CATGTCAGGAGGAAAGATGATGG + Intergenic
1132191614 15:99867176-99867198 CATCCCAGGAGCAAACAGGAAGG + Intergenic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1133410960 16:5568433-5568455 CAGGAAAGGGGGAAAGAGAAGGG - Intergenic
1134628357 16:15739077-15739099 CAGCAGTGGGGGATAGAGGAAGG - Intronic
1135036572 16:19083250-19083272 CACCAATGGTGGAAAGAGGAAGG + Intergenic
1135101211 16:19607634-19607656 CATCACAATGGGCCAGAGGAAGG - Intronic
1135833514 16:25800438-25800460 CATCAGAGAGAGAAAGAGGTGGG - Intronic
1136127738 16:28196803-28196825 GATCACAGGGCAAGAGAGGAAGG - Intronic
1136146162 16:28317779-28317801 CAGCCCAGGGGGAAAGAGACTGG + Intronic
1136859794 16:33691498-33691520 CATCTCATGGGGAAAGTGGAAGG + Intergenic
1137465114 16:48700696-48700718 CATCAGATGGGGGAAGAGGGAGG - Intergenic
1137882030 16:52059203-52059225 CATTATAGGGGGGAAGGGGATGG + Intronic
1138073200 16:54014414-54014436 CATCACACGGAGAGAGAGAAAGG - Intronic
1138275168 16:55729047-55729069 CACCCCAAGGTGAAAGAGGAAGG + Intergenic
1138514895 16:57530638-57530660 CCTCTCAGGGGCAGAGAGGAGGG - Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139952148 16:70677700-70677722 CAGTAAAGGGGAAAAGAGGATGG - Intronic
1141155196 16:81592504-81592526 CACCGCAGGAGGAAGGAGGAGGG - Intronic
1141376596 16:83536447-83536469 CATCACAGGGAGAGAGAAAAGGG + Intronic
1141748532 16:85942615-85942637 CAGCACAGGAGGAAAGAGAGTGG - Intergenic
1203121300 16_KI270728v1_random:1539677-1539699 CATCTCATGGGGAAAGTGGAAGG + Intergenic
1143129449 17:4667759-4667781 AATAATAGGGTGAAAGAGGATGG - Intergenic
1143596154 17:7915573-7915595 GAGCACTGGGGGAAAGAAGAAGG + Intergenic
1143838701 17:9713567-9713589 CATCACAGGGGGCAAGAGTGGGG + Intronic
1144217907 17:13072722-13072744 CAACACAGAGGGAGAGAGAAGGG - Intergenic
1145754072 17:27377494-27377516 CATCACAAGAAGAAAAAGGATGG + Intergenic
1145773777 17:27512132-27512154 CACTACAGGGAGAAAGAGCAGGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146124405 17:30220500-30220522 CATCCCAGGAGGAGATAGGAGGG + Intronic
1146792553 17:35760695-35760717 CATTAAAGGGGAAGAGAGGATGG - Intronic
1147367736 17:39970403-39970425 AATGACAGAAGGAAAGAGGAGGG + Intronic
1147422877 17:40331292-40331314 CAGCATAGGGGGGAAGAAGAAGG - Exonic
1147596979 17:41723848-41723870 CAGCACAGGAGTAGAGAGGACGG + Exonic
1147673418 17:42189763-42189785 CATCGCAGGGGGGAAGGGGGAGG + Exonic
1147820055 17:43236049-43236071 CATCACAGGGAGACAGACGTTGG - Intergenic
1147821369 17:43243448-43243470 CATCACAGGGAGACAGACGTTGG - Intergenic
1147822166 17:43247931-43247953 CATCACAGGGAGACAGACGTTGG - Intergenic
1147823090 17:43253377-43253399 CATCACAGGGAGACAGACGTTGG - Intergenic
1147823860 17:43257977-43257999 CATCACAGGGAGACAGACGTTGG - Intergenic
1147824619 17:43262417-43262439 CATCACAGGGAGACAGACGTTGG - Intergenic
1147827795 17:43280241-43280263 CATCACAGGGAGACAGACGTTGG - Intergenic
1147828903 17:43286402-43286424 CATCACAGGGAGACAGACGTTGG - Intergenic
1147829998 17:43292545-43292567 CATCACAGGGAGACAGACGTTGG - Intergenic
1147834974 17:43323594-43323616 CATCACAGGGAGACAGACGTTGG + Intergenic
1147943550 17:44066857-44066879 AATGAAAAGGGGAAAGAGGAGGG + Intronic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1149461319 17:56832432-56832454 CATCCCAGAGAGACAGAGGAAGG - Intronic
1149571792 17:57677406-57677428 CGTCCCAGGGGGATAGAGGCAGG + Intronic
1150892861 17:69174435-69174457 GGTCATAGAGGGAAAGAGGAGGG + Intronic
1151905681 17:77047107-77047129 CATGACAGGGGGTAAGCTGAGGG - Intergenic
1152099581 17:78293264-78293286 CATCCCTGGGGTAAAGTGGATGG - Intergenic
1152287567 17:79421747-79421769 CACCACAGGAGGAGAGAGCATGG - Intronic
1152444097 17:80330590-80330612 AATCTCAGGGGGAAGGAGGATGG - Intronic
1153133241 18:1882074-1882096 CATCACAGGTAAAACGAGGAAGG - Intergenic
1153780402 18:8490531-8490553 CATCACATGGTGAGAGAGGGAGG + Intergenic
1153970125 18:10218554-10218576 CCTGACAGGCTGAAAGAGGAGGG + Intergenic
1154266070 18:12880259-12880281 CAACACAGTGGAAAAGAGGGAGG + Intronic
1154310875 18:13265413-13265435 CAGCACAGTGGGAAGGGGGAGGG - Intronic
1154384853 18:13884025-13884047 ACTAACAGGGAGAAAGAGGAGGG + Exonic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1155089091 18:22488900-22488922 CAGCAAAGGGGGAAAGAGCAAGG - Intergenic
1155537258 18:26830364-26830386 CATCACAGAGGGGAGGAGAAAGG - Intergenic
1156220365 18:35044726-35044748 CAGCACAGGTGAGAAGAGGAGGG + Intronic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1156421298 18:36956002-36956024 AATCACAGGTGGAGAGTGGAAGG - Intronic
1157297974 18:46459604-46459626 CATCTGTGGGGGAAGGAGGAGGG - Exonic
1157539627 18:48490946-48490968 CAACAAAGTGGGAAAAAGGAGGG + Intergenic
1158441678 18:57480114-57480136 CCACATAGGGGGAATGAGGAGGG - Exonic
1158605447 18:58891777-58891799 CACCAGGGTGGGAAAGAGGATGG - Intronic
1158818742 18:61133985-61134007 CCTCATAGGGGAAAAGATGAAGG + Intergenic
1159142661 18:64416567-64416589 AATTAGTGGGGGAAAGAGGAAGG - Intergenic
1159627398 18:70710626-70710648 CACCAGAAGGGGACAGAGGATGG - Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1160564912 18:79781037-79781059 CTTCATAGGGAGAAAAAGGAGGG - Intergenic
1161356788 19:3823511-3823533 CATCACAGGAGGGAGGGGGATGG - Intronic
1162432244 19:10636109-10636131 CATCACTGGGGTCAAGAAGAGGG - Intronic
1162866501 19:13551878-13551900 GGTCACAGGGGCAGAGAGGAGGG - Intronic
1162870278 19:13581175-13581197 CACCAAAGGGGGAAAGAAAATGG + Intronic
1163128463 19:15257273-15257295 CAACCGAGGGCGAAAGAGGATGG + Intronic
1163181447 19:15607046-15607068 TAGCACACGGGGTAAGAGGAGGG + Intergenic
1163223122 19:15935683-15935705 CCTTAGAGGGGGACAGAGGAGGG + Intergenic
1163545942 19:17941675-17941697 CAGCACAGCAGGAAAGTGGAGGG - Intronic
1164861661 19:31566537-31566559 CCTGACAGGGGGAAAGAGGAGGG + Intergenic
1165184285 19:34003546-34003568 AATCACAGGGGAAAAAATGAAGG + Intergenic
1165685202 19:37813750-37813772 CACCACAAGGGAAAAGAGGTGGG + Intronic
1166333176 19:42090403-42090425 CTTCAAAGGGGAAAAGAGGGAGG + Exonic
1167081005 19:47275970-47275992 CAGCACAGGAGACAAGAGGAGGG + Intergenic
1167224081 19:48225159-48225181 CACAACAGAGGGAAAGAAGAGGG + Intronic
925184649 2:1838775-1838797 CGTCATTGGGGGAAAGAGGATGG - Intronic
925691063 2:6523733-6523755 CATCTCAGGAGGAAAGATTATGG - Intergenic
925693851 2:6553171-6553193 TATAAAAGGGTGAAAGAGGATGG - Intergenic
925741739 2:7010805-7010827 CACTACAGGGGTAGAGAGGAGGG - Intronic
926209872 2:10861984-10862006 CAGGACAGGGGGACACAGGAAGG - Intergenic
926670400 2:15572226-15572248 CATCTCAAAGGGACAGAGGAAGG - Intergenic
926975049 2:18506417-18506439 AAAAAGAGGGGGAAAGAGGAAGG - Intergenic
927266955 2:21162397-21162419 AAGCACAGGGGGAAAGCTGAGGG - Intergenic
928136789 2:28693795-28693817 CATCCAAGGGGGAAGGAGGATGG - Intergenic
928615691 2:33037246-33037268 CAACACAGTAGGATAGAGGATGG - Intronic
928719104 2:34098616-34098638 CATCACAGGGTTTAAGAAGAAGG + Intergenic
930036316 2:47087482-47087504 GGTCACCGGGGGAAAGATGATGG - Intronic
930767353 2:55097555-55097577 CAGCAGTGGGGGAAGGAGGAGGG + Intronic
931316831 2:61140841-61140863 TATCTCTGGGGGACAGAGGAAGG + Intergenic
931630789 2:64296666-64296688 CATCATAGGGAGGAAGGGGAGGG + Intergenic
932149232 2:69354254-69354276 GATCACAGGGAGAAAGAGGTGGG - Exonic
932196446 2:69788184-69788206 CATCACAGGGTCACACAGGAGGG + Intronic
933889747 2:86756795-86756817 GCTCACAAGGGAAAAGAGGAAGG + Intronic
934458154 2:94192606-94192628 CATCTCATGGGGAAAGTGGAAGG + Intergenic
934867545 2:97826477-97826499 CATCAAAAGGGGAAGGAGAAGGG + Intronic
936344625 2:111665888-111665910 CATCACAGAAGGAAGGTGGAAGG - Intergenic
937122586 2:119451285-119451307 CAGCATAGGGGGACAGAGGAGGG - Intronic
937318089 2:120944677-120944699 CTTCACAGGGGCAGAGAGGCTGG + Intronic
937796175 2:126023729-126023751 CATCACAGAGAGAAATAAGATGG + Intergenic
937985308 2:127635645-127635667 CATCTGAGCGGGAAAGAGGTTGG + Intronic
938162958 2:129002917-129002939 TCTCACAAGCGGAAAGAGGATGG - Intergenic
939373005 2:141327000-141327022 CAGCAAAGGGGAAAAAAGGAAGG + Intronic
939590232 2:144055457-144055479 CATCATAGGGTGAAATATGAAGG - Intronic
939664831 2:144938280-144938302 CATTACAGAGGGAAAGATGAGGG + Intergenic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
943453964 2:188079535-188079557 CAACACAGGAGGAAGGAGAATGG + Intergenic
944143917 2:196485669-196485691 CATAACAAGGGGACCGAGGAAGG + Intronic
944881442 2:204017036-204017058 CATCACACGGCAAGAGAGGAAGG + Intergenic
945517467 2:210780145-210780167 CATCACATGGGAACACAGGAGGG + Intergenic
946125537 2:217559294-217559316 CATCTCTGGGAAAAAGAGGAAGG + Intronic
946722234 2:222621922-222621944 TATCACTGGGGGGAAGAGAAAGG - Intronic
947025741 2:225735699-225735721 CATCAAAGGAGGAAAGACGAAGG - Intergenic
947857164 2:233331831-233331853 CCTCGAAGGGAGAAAGAGGAAGG - Intronic
948048402 2:234961023-234961045 CATCACAGTGGGAAAGAGCAGGG + Intronic
948253804 2:236551618-236551640 GACCAGAGGGGGAAAGGGGAAGG - Intergenic
948316550 2:237031801-237031823 CATGGTATGGGGAAAGAGGAAGG + Intergenic
948387072 2:237587377-237587399 CACCACAGTGGGCAAGAGGGAGG + Intronic
1168935734 20:1664044-1664066 CATCACATGGTGAGAGAGGAAGG + Intergenic
1169163686 20:3405000-3405022 CATGACAGAAGGAAAGAGAATGG + Intronic
1169263998 20:4156661-4156683 CCTCACTGGGTGAATGAGGAAGG + Intronic
1170479783 20:16754419-16754441 CATCACAGTGGGCAAGAGAAAGG - Intronic
1170791613 20:19513409-19513431 GATCACAGGGGCAAAGTGCAAGG + Intronic
1170955437 20:20975068-20975090 GATCCCAGGGGGTAAGAGGAAGG + Intergenic
1171282490 20:23912389-23912411 GGTCACAGGGGGTGAGAGGAGGG + Intergenic
1172131820 20:32661054-32661076 TATCAAGGAGGGAAAGAGGAAGG + Intergenic
1172134994 20:32680908-32680930 CATCAGAGAGGGAAAGAGGAAGG - Intergenic
1172657701 20:36547027-36547049 CATCCCAGGGGGACACAGCAGGG + Intronic
1173450335 20:43158080-43158102 AATCCCAGGGGAAAAGAGGGTGG + Intronic
1173452838 20:43180388-43180410 TATGACAGGGAGAGAGAGGAAGG - Intronic
1173871450 20:46344566-46344588 GTGCACATGGGGAAAGAGGAGGG - Intergenic
1175145687 20:56894537-56894559 CATCCCGGGGGGAAGGTGGAAGG + Intergenic
1175473552 20:59252050-59252072 CTTCTCATGGGGAGAGAGGAGGG - Intronic
1175743577 20:61437393-61437415 CGTCACAGGGAGACAGAAGATGG - Intronic
1178043011 21:28662370-28662392 CAGCGGAGGGGGAAAGAGGGAGG - Intergenic
1178318215 21:31584822-31584844 CAGCACAAGGGAAACGAGGATGG + Intergenic
1178717985 21:34984265-34984287 CATCACAGTGTGAAAAAGCAAGG + Intronic
1179058218 21:37955327-37955349 TATCACAGGGGGAGGGAGGATGG + Intronic
1179337826 21:40474555-40474577 CAGCTCAGGGGGGAAGGGGAGGG - Intronic
1179514448 21:41897189-41897211 CCAGACAGGGGGAAGGAGGAGGG + Intronic
1181358057 22:22313821-22313843 CATCTCATAGGGAAAGTGGAAGG - Intergenic
1181666056 22:24398208-24398230 CATCTCAGGGGCAAAGAGCAGGG + Intronic
1181740822 22:24920053-24920075 CATCTCAGGAGGAATGAAGATGG + Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183350598 22:37332663-37332685 AATCACAGGAGGATAGAGCATGG - Intergenic
1184392762 22:44214424-44214446 CAGCACAGGGGCCAAGAAGATGG - Intronic
1184923750 22:47623551-47623573 CATCACAGGCAGAAAGCGCACGG + Intergenic
949624479 3:5851344-5851366 CATCACATGGCAAGAGAGGAAGG - Intergenic
950031740 3:9858336-9858358 CATCACAGGGGGGAGGGGCAAGG + Intergenic
950226278 3:11237341-11237363 CTTCACAATGGAAAAGAGGATGG + Intronic
950464959 3:13148267-13148289 CCTCACAGAGGGAGGGAGGAGGG + Intergenic
950840599 3:15964815-15964837 CATCCAAGGAAGAAAGAGGAAGG - Intergenic
951473102 3:23077566-23077588 CAGCAGCGTGGGAAAGAGGAAGG - Intergenic
951887018 3:27534359-27534381 AATAACAGTGGGAAAGAGGAAGG + Intergenic
951926765 3:27916181-27916203 CATTGCAGGGGGTAAGATGAGGG - Intergenic
952531093 3:34262747-34262769 CATCCCAGGGTGTAAAAGGAAGG + Intergenic
953622518 3:44545552-44545574 CATCAAAAGGGGAAAGAGAAGGG - Intergenic
953666061 3:44927497-44927519 CACCAGAGGAGGAAGGAGGAGGG + Intronic
953686286 3:45080889-45080911 AATCACATGGTGAGAGAGGAAGG - Intergenic
953827646 3:46267936-46267958 CATCCCAAGGGGAGAGAGGAGGG + Intergenic
954445711 3:50545832-50545854 CCTCAAAGGGGGCAGGAGGAGGG - Intergenic
954588357 3:51756827-51756849 CATCACATGGTGAGAGAGGAAGG + Intergenic
954743430 3:52772786-52772808 TATCTCAGAGGGACAGAGGAAGG + Intergenic
955104684 3:55885835-55885857 CATTACAGGAGGAAACTGGAAGG + Intronic
955515292 3:59720457-59720479 AATAACAGGAGGATAGAGGAAGG + Intergenic
956326067 3:68054355-68054377 GATCACATGGAGAGAGAGGAGGG - Intronic
956340848 3:68222314-68222336 TATCAGAGGAGGAAATAGGAAGG - Intronic
957067470 3:75537526-75537548 AGTGACAGGGGGCAAGAGGACGG - Intergenic
957083948 3:75663298-75663320 CAGCAGAGGGGGAGAGAAGAAGG + Intergenic
957147492 3:76443098-76443120 CATCACATGGCGAGAGAGGAAGG + Intronic
957245616 3:77712267-77712289 CATCATGAGGGGAAAGAGGAGGG - Intergenic
959584819 3:108016121-108016143 CATCACAGGAAGAGAGGGGATGG - Intergenic
960172657 3:114480776-114480798 CAGCAAAGAGGCAAAGAGGATGG + Intronic
960367080 3:116785699-116785721 AATCACAGGGGAAAAGATCAAGG - Intronic
960523355 3:118681229-118681251 CATCACATGGTGAGAGAGGAAGG - Intergenic
961285676 3:125800446-125800468 AGTGACAGGGGGCAAGAGGACGG + Intergenic
961545067 3:127627791-127627813 CCTCAGAGGAGGAAAGAAGAGGG + Intergenic
962631181 3:137277620-137277642 CAAAACAGGGGCAAAAAGGAAGG - Intergenic
963587358 3:147209250-147209272 AATCAAAGGGAGAAAGAAGAGGG - Intergenic
963917692 3:150874345-150874367 CAGCACTGGGGGTAAGAGCAGGG + Intronic
964879815 3:161410919-161410941 CATCTCAAAGGGACAGAGGAAGG + Intergenic
964884563 3:161466385-161466407 CATCACATGACAAAAGAGGAAGG - Intergenic
965142751 3:164861074-164861096 CCTGACAGGTGGAAAGAGTATGG - Intergenic
965537169 3:169835475-169835497 CATCACAGGGGCAACTGGGATGG + Intronic
965903879 3:173678503-173678525 ATTAACAGGTGGAAAGAGGATGG + Intronic
967019230 3:185507973-185507995 CTTCACATGGGGACAGGGGATGG - Exonic
967658775 3:192079804-192079826 ATTCACAGGAGGAAAGGGGAAGG - Intergenic
968298552 3:197595723-197595745 CATCACAGGGAGGAAGTGGAAGG - Intergenic
969801408 4:9568510-9568532 AGTGACAGGGGGCAAGAGGACGG + Intergenic
969946836 4:10791827-10791849 GATGAGAGGGGGAGAGAGGAAGG - Intergenic
970113257 4:12662771-12662793 CATCAAATAGAGAAAGAGGAAGG + Intergenic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
970322188 4:14885862-14885884 GATCAAAGGGAGAAAGAGGCAGG + Intergenic
972362841 4:38344938-38344960 CAGAACAGGGTGAAAGGGGAAGG - Intergenic
973189958 4:47375644-47375666 CATTACAAGGGAAAAGAGCATGG + Intronic
973665447 4:53154344-53154366 TATCACATGGTGAAAGAGAATGG + Intronic
973666970 4:53170287-53170309 CCACACAGTGGGAAAAAGGATGG - Intronic
974388997 4:61240194-61240216 CCTCACTGGTGGAAAGTGGAAGG + Intronic
975798634 4:78035524-78035546 GGTCACAGTGGGAAAGAGGAAGG + Intergenic
975801736 4:78067233-78067255 CATTAAAAGGGGAAAGAGTATGG - Intronic
975992732 4:80276643-80276665 GAACTCAGGGGGAAAGGGGAGGG - Intronic
976230492 4:82837731-82837753 AATCACTGGGGGAAGGAAGAGGG + Intronic
976764103 4:88581054-88581076 CATCAGAGGGCAAAGGAGGAAGG + Intronic
977089630 4:92653974-92653996 CTTCATATGTGGAAAGAGGATGG + Intronic
978357242 4:107890302-107890324 CAGCAGAGGGTGAAAGAGAAAGG + Intronic
979306786 4:119155074-119155096 CATCACATGGTGAGAGAGGAAGG + Intronic
979793019 4:124809932-124809954 CATTTCAGTGGGAAAGTGGAAGG - Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
982101409 4:151971817-151971839 GATCACATGGTGAAAGAAGAAGG - Intergenic
983521629 4:168715495-168715517 CTTAACAGGAGGAAAAAGGAGGG + Intronic
984031330 4:174607521-174607543 CAGCACAGGGTGCAAGAGAAAGG - Intergenic
984290874 4:177792312-177792334 CATCACATGGTGGGAGAGGAAGG + Intronic
984574119 4:181427698-181427720 CATGACAGGGAGAAAGAGACGGG + Intergenic
986461397 5:7976041-7976063 CTTCACAGTGGGAAAAGGGAAGG - Intergenic
986636048 5:9823560-9823582 CAGAAAGGGGGGAAAGAGGAAGG + Intergenic
987201413 5:15581460-15581482 CATCACAGAGGAAAAGTGGAGGG - Intronic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988026629 5:25701849-25701871 CTTTACAGGGGGAAAGGGGTAGG - Intergenic
988651804 5:33160616-33160638 CATCAAAGGAGGGAAGAGAATGG - Intergenic
989814672 5:45721829-45721851 AATGAGAGGGGGAAAAAGGAAGG + Intergenic
990560818 5:56981187-56981209 CATCAAAGTGGGAGGGAGGACGG + Intergenic
990723549 5:58726904-58726926 AAGCACAGGGCTAAAGAGGACGG + Intronic
990880993 5:60539260-60539282 CATCACAGTGAGGAATAGGAGGG - Intergenic
991323205 5:65399655-65399677 TATCACAAGGGAAAGGAGGAAGG - Intronic
991918653 5:71631498-71631520 CATGACATAGGGAAAGAGGATGG + Intronic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992624142 5:78621864-78621886 CAGCTTAGGGGGAAAGGGGAAGG - Intronic
993015372 5:82529828-82529850 AATCACAAGGGAAATGAGGAAGG - Intergenic
993361508 5:86982168-86982190 CAGCAAAAGGGGAAAGAGGAAGG - Intergenic
993736257 5:91479859-91479881 CCTAACTGGGAGAAAGAGGATGG - Intergenic
994363783 5:98886977-98886999 CAACACAGGGCAGAAGAGGAAGG + Intronic
996697593 5:126416011-126416033 CATGGCAGGAGGAAAGAGAAAGG + Intronic
997743482 5:136278383-136278405 CCTCACAGGGGCAATGAGGAAGG - Intronic
999001239 5:147925208-147925230 TATCACATGGTGAGAGAGGAGGG + Intergenic
999054268 5:148557013-148557035 TATCACAGGGGAAATGAGCAAGG + Intronic
999973871 5:156891752-156891774 CATCATAGGGAGAATGAGGCTGG - Intergenic
1000920595 5:167132487-167132509 CTTCTCAGGGGGAAGGAAGAGGG - Intergenic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1002483131 5:179516682-179516704 CCACACAGGTGGAGAGAGGAGGG - Intergenic
1003187861 6:3848964-3848986 CATCAGAGGCGGGAGGAGGAGGG + Intergenic
1003638307 6:7854953-7854975 GGTAAGAGGGGGAAAGAGGATGG - Intronic
1004680766 6:17892299-17892321 CATTAGAGCAGGAAAGAGGAAGG - Intronic
1005835463 6:29705532-29705554 CATCACAGGGACACACAGGATGG - Intergenic
1006036230 6:31214932-31214954 CATCCCATGGTGAAAGAGGTAGG + Intergenic
1007404424 6:41625838-41625860 CAAGAGAGGGGGACAGAGGAAGG - Intergenic
1007706754 6:43795769-43795791 CTTCAGAGAGGGAGAGAGGATGG - Intergenic
1007725721 6:43914563-43914585 CATCATGGGGGGACAGGGGAGGG + Intergenic
1007835077 6:44667907-44667929 CATCACAGGGTTAAAGAACAAGG + Intergenic
1007902156 6:45422468-45422490 CGAGACGGGGGGAAAGAGGATGG - Intronic
1007986153 6:46209006-46209028 CTTCTCAGGTGGAAAGGGGATGG - Intergenic
1008147337 6:47907733-47907755 CAGCACAGGGGAACAGAGGTAGG - Intronic
1008383789 6:50863603-50863625 CTCCAAAGGGGGAATGAGGAAGG + Intergenic
1009869655 6:69437906-69437928 CAACACAGGAGCAAAGAAGAAGG + Intergenic
1010040933 6:71383058-71383080 CACCACTGGAGAAAAGAGGAGGG + Intergenic
1011145334 6:84208409-84208431 CATCACACTGAGAAACAGGATGG + Intronic
1011443761 6:87415108-87415130 TATCACAGGAGGAATGAGGAGGG + Intronic
1013424430 6:109998222-109998244 CATCTCAGAGGGAGAGAGGGAGG + Intergenic
1013721633 6:113037155-113037177 CATCAGATGGGGAAAAAGAATGG - Intergenic
1014647492 6:123992261-123992283 GATAACTGGAGGAAAGAGGAAGG + Intronic
1015211942 6:130708604-130708626 GATCACATGGTGAGAGAGGAAGG + Intergenic
1015262945 6:131259380-131259402 CATCACAAGAGGAAAGCTGAAGG + Intronic
1015701014 6:136036237-136036259 TATCAGAGAGGGAAAAAGGAAGG + Intronic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1016507880 6:144804803-144804825 CATCTCAAAGGGACAGAGGAAGG + Intronic
1016804201 6:148196546-148196568 GCTCACTGGGAGAAAGAGGATGG - Intergenic
1016945640 6:149530206-149530228 CAAGACTGGGGGAAAGAGGGAGG + Intronic
1017315977 6:153031917-153031939 CAGCAAAGTGTGAAAGAGGAAGG + Intronic
1017743521 6:157427172-157427194 GAGCACAGGAGGAAGGAGGAAGG + Intronic
1018153860 6:160966612-160966634 GATCACAAGGAGAAACAGGAAGG - Intergenic
1019313210 7:372812-372834 CCTCACAGTGGGGAAGAGAAGGG - Intergenic
1019364850 7:628016-628038 CATCACAGGGGGACAGCGGTGGG + Intronic
1019501224 7:1365656-1365678 CAGCACAGGGAGTGAGAGGAAGG + Intergenic
1020737035 7:11963709-11963731 CATCAAGGGTGGTAAGAGGAAGG + Intergenic
1021387552 7:20050446-20050468 CTTCACTGGGGGAATGAGGCTGG - Intergenic
1021930987 7:25581179-25581201 TATCTCAGGGTGAAAGAGGTCGG + Intergenic
1022205468 7:28159450-28159472 CAGCACAGGAGCAGAGAGGAAGG + Intronic
1022950046 7:35329520-35329542 CATCAAATGGGCAAAGATGAAGG + Intergenic
1023358753 7:39394776-39394798 GCTCAGTGGGGGAAAGAGGAGGG - Intronic
1024243763 7:47454516-47454538 CAGCCCTGGGGGAGAGAGGAGGG + Intronic
1024356896 7:48422813-48422835 CATCAAAGGGGGATCGAGGAAGG + Intronic
1026440808 7:70442130-70442152 CATCACCCAGGGAAAGAGAATGG + Intronic
1026472327 7:70704332-70704354 CATCACAGGGGCACTCAGGATGG - Intronic
1026489033 7:70846856-70846878 AATGACAGGGGGCAAGAGGACGG - Intergenic
1026520135 7:71110250-71110272 CATCCCAAAGGGACAGAGGAAGG - Intergenic
1029599656 7:101556234-101556256 CACCATAGGGACAAAGAGGAGGG - Intronic
1029794057 7:102875380-102875402 GAGGACAGGGGAAAAGAGGAGGG + Intronic
1030412101 7:109193421-109193443 TGTCACAGGGGGAAGGATGAGGG + Intergenic
1031971660 7:128069027-128069049 CATCACAGGGCCAAAGCGGTGGG - Intronic
1032486114 7:132288683-132288705 CCCCACAGGGGCAGAGAGGATGG + Intronic
1033935354 7:146577223-146577245 CTGCACAGGGGTAAAGAGGTAGG + Intronic
1034590904 7:152138133-152138155 AATCACAGTGGGAAAGACCAAGG + Intronic
1034737856 7:153445789-153445811 CATCACAGATGGAATGAGGGTGG + Intergenic
1036526848 8:9542814-9542836 CACCACATGGTGAAAGAGGAAGG + Intergenic
1036779165 8:11633974-11633996 GACCCCAGGAGGAAAGAGGAGGG - Intergenic
1037672235 8:21024924-21024946 CATCACAGGGATAAAGAGAAAGG + Intergenic
1038165890 8:25084779-25084801 CATTGTAGGAGGAAAGAGGAAGG + Intergenic
1038666381 8:29541339-29541361 AAACAAAGGGGTAAAGAGGATGG - Intergenic
1040845075 8:51829430-51829452 CATCCCAGAGGAAAAGAGAAAGG - Intronic
1041305590 8:56454915-56454937 CATCCCAATGGGACAGAGGAAGG - Intergenic
1041555531 8:59150347-59150369 TATCACAGGATGAAAGAGGAAGG - Intergenic
1041971616 8:63749529-63749551 CATCACAGAAGTAAAGGGGATGG - Intergenic
1042846293 8:73172589-73172611 AAACACAGGGGGAAAGAACAGGG - Intergenic
1043133158 8:76487528-76487550 AATCACCGGGGGATAGAGGCAGG + Intergenic
1044121562 8:88403454-88403476 CAACACAGGAGAAGAGAGGATGG - Intergenic
1045558921 8:103241855-103241877 CATCAGAGAGGGAGAAAGGAAGG - Intergenic
1045766769 8:105681705-105681727 ATTTACAGGGGGAAAAAGGAAGG - Intronic
1046034030 8:108820157-108820179 CTTCATTGGGAGAAAGAGGAAGG + Intergenic
1047650719 8:126917125-126917147 AATAATGGGGGGAAAGAGGAAGG - Intergenic
1047700861 8:127448131-127448153 TTTCACAGGGAGGAAGAGGAAGG + Intergenic
1048132574 8:131714000-131714022 CATCACTGGGGGAAAGAGGAAGG - Intergenic
1048251941 8:132873794-132873816 GAGCACAGAGGGTAAGAGGAAGG + Intronic
1049010269 8:139882646-139882668 CAGCACAGGGGGTAGGAGGGTGG + Intronic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1049802322 8:144523599-144523621 CATCACAGAGCTAAAGGGGAGGG - Exonic
1050102368 9:2132238-2132260 CCTCACAGGTGTAAAGAGGTGGG + Intronic
1050271259 9:3947828-3947850 CAAGACAGGGGGAAAGAGAGTGG + Intronic
1050699110 9:8317402-8317424 CATTTTAGGGGGAAAGGGGAGGG - Exonic
1052792663 9:32890221-32890243 AATCCCAGGGGGAAACAGTAAGG - Intergenic
1053043562 9:34894689-34894711 CATCACACTGGGAGTGAGGAAGG + Intergenic
1054275369 9:63062646-63062668 CATCTCATGGGGAAAGTGGAAGG - Intergenic
1054399462 9:64702285-64702307 CATCTCATGGGGAAAGTGGAAGG + Intergenic
1054433043 9:65186550-65186572 CATCTCATGGGGAAAGTGGAAGG + Intergenic
1054497340 9:65835125-65835147 CATCTCATGGGGAAAGTGGAAGG - Intergenic
1056383981 9:86080459-86080481 CAACAGAGGAGGAAAGGGGATGG + Intronic
1056497674 9:87176151-87176173 CATCACATGGGGGGAGAGGGGGG - Intergenic
1057375236 9:94515223-94515245 CATCCCTGAGGGAGAGAGGAAGG + Intergenic
1057499604 9:95586092-95586114 GATCACGGGAGCAAAGAGGAAGG - Intergenic
1058804135 9:108574141-108574163 CTTTAAAGGGGGAAATAGGAGGG - Intergenic
1058972852 9:110098923-110098945 CAGAGCTGGGGGAAAGAGGAAGG - Intronic
1059447246 9:114346030-114346052 CATCAGAGGGGGCAAGGGGTGGG + Intronic
1060096747 9:120797569-120797591 GATCACAGTGGGTAAGAGGTTGG - Intergenic
1060442455 9:123654778-123654800 CATCCCAGAAGGAAAGAGGCAGG - Intronic
1061308470 9:129746644-129746666 CATCACAGGCGGAAATGGGTGGG - Intronic
1061386651 9:130294624-130294646 CAGCACAGAGGGAAGGAGCAAGG - Intronic
1185448573 X:271280-271302 CATCACACCAGGACAGAGGAAGG + Intergenic
1185448965 X:272900-272922 CATCACACCAGGACAGAGGAAGG + Intergenic
1185586084 X:1243029-1243051 CCCCACAGGAGGAAAGAGCAGGG + Intergenic
1186262506 X:7794486-7794508 GATCACAGGGTGTAAGATGAAGG + Intergenic
1187252582 X:17612325-17612347 CAGAACCGGGGGAAAGAGGCAGG - Intronic
1188146146 X:26616379-26616401 CATCACATGATGAGAGAGGAAGG + Intergenic
1188411159 X:29873518-29873540 CATCACAGGGCGGAAGTGGGGGG - Intronic
1188440550 X:30211639-30211661 GATCACAGGGGGAAAAATCAAGG - Intergenic
1188927280 X:36059976-36059998 GATCACATGGTGAGAGAGGAAGG - Intronic
1189053142 X:37667865-37667887 CATCACATGGGGAGAGAAGAAGG + Intronic
1189257532 X:39652143-39652165 CATGAAAGAGGGAATGAGGAAGG - Intergenic
1190605995 X:52143438-52143460 CATCACATGGCAAAAGAGGAAGG + Intergenic
1190793866 X:53723553-53723575 CATCACATAGTGAAAGATGAGGG - Intergenic
1192412557 X:70947280-70947302 CATCACATGGCAAGAGAGGAAGG + Intergenic
1193942617 X:87694787-87694809 GATCACATGGTGAAACAGGAAGG + Intergenic
1195213453 X:102672756-102672778 CAGCAAAGGGGGAAAAAGCATGG + Intergenic
1195232443 X:102863955-102863977 CATCACAGTAGGAAAGTGGGAGG + Intergenic
1195354520 X:104026323-104026345 CATCCCAGGAGGAGAAAGGAGGG + Intergenic
1195449133 X:104990380-104990402 CATCCCAAGGGGAGAGAGGGTGG - Intronic
1196829952 X:119767985-119768007 CATCACATGGTGATAGAGGAAGG - Intergenic
1196891590 X:120295986-120296008 CATCAGAGGGGGAGACAAGATGG - Intronic
1197128918 X:122981216-122981238 CATCACAGAGTGAATCAGGAGGG - Intergenic
1198647893 X:138829412-138829434 GATCACATGGTGAGAGAGGAAGG - Intronic
1198714696 X:139544674-139544696 AATCCCAGGGGGCAAGAGAAAGG + Intronic
1200259374 X:154604177-154604199 CATCACATAGTGAGAGAGGAAGG + Intergenic