ID: 1107198115

View in Genome Browser
Species Human (GRCh38)
Location 13:37679395-37679417
Sequence TATGGTAATACATTGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107198115 Original CRISPR TATGGTAATACATTGATTAC AGG Intronic
902532906 1:17101930-17101952 GACGGTAAAACATTGAGTACTGG + Intronic
904859415 1:33523637-33523659 TATGTTAATAATTGGATTACCGG + Intronic
905701351 1:40018092-40018114 TAAGGCAATACATTGAAAACTGG - Intergenic
906054269 1:42902575-42902597 CTTGGTAATAGATTGAGTACTGG + Intergenic
906464260 1:46062156-46062178 TATGGGATTACATTAATAACTGG - Intronic
906682445 1:47738628-47738650 AACGGTAATACATTGAATCCAGG + Intergenic
907785310 1:57605818-57605840 TGTCTTAATAAATTGATTACTGG - Intronic
909193768 1:72589505-72589527 TATTGTACTACATTCATTATTGG - Intergenic
911974595 1:104475938-104475960 ATTGCTAATATATTGATTACTGG + Intergenic
917394800 1:174581893-174581915 TATGGTAATTCCTAGATTTCTGG + Intronic
918374605 1:183896602-183896624 TATGGTAATACATAAATCTCAGG + Intronic
919081291 1:192869167-192869189 TATGTTAATTCATTGTTTACTGG - Intergenic
919244081 1:194954843-194954865 TATGTTCATCCCTTGATTACTGG - Intergenic
920229056 1:204458394-204458416 GATGGTAATAAATTAATTAAGGG - Intronic
920544722 1:206806625-206806647 TATTGTGATACATTTTTTACTGG - Intronic
921117570 1:212108315-212108337 TGTGGTAATAGATTGATAAAGGG - Intergenic
921477084 1:215624358-215624380 TGGGGTAATACATTGTTTTCAGG + Exonic
923970218 1:239193268-239193290 TATGCTAATACAATGTTAACAGG - Intergenic
924005467 1:239605659-239605681 TATGGTTATACATTGTAAACTGG - Intronic
1066027869 10:31382399-31382421 TTTTGTAAAACATAGATTACTGG + Intronic
1072611232 10:97018854-97018876 TATGTTAAGTCATTAATTACAGG + Intronic
1073187659 10:101626351-101626373 TAGGGTAATCCATTAATAACTGG + Intronic
1073383067 10:103096138-103096160 TATGGTAAAGCATTAATTTCTGG - Intronic
1083157896 11:60836693-60836715 TATGTTAAAACACAGATTACTGG - Intergenic
1086816307 11:91376570-91376592 TATGGTAGCACATTGATGAAAGG + Intergenic
1087477510 11:98655188-98655210 TTTGGTGACACATTGATTTCTGG - Intergenic
1088235427 11:107718126-107718148 TTTGGTTATACATTGAATACTGG + Intronic
1088559128 11:111095176-111095198 TATTGTAATACATTCATTTATGG + Intergenic
1088611333 11:111580116-111580138 TATTGTCATACATTGATAATGGG + Intergenic
1091151759 11:133335523-133335545 TATGATATTACATAGATTAAAGG + Intronic
1092447410 12:8570036-8570058 TATGCTGATATATTGATTCCTGG - Intergenic
1095698218 12:45164652-45164674 TATGTTAAAACATAGATTGCTGG - Intergenic
1099597662 12:84688235-84688257 TATGGTAAGACATTGAGCTCTGG - Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101790778 12:107925585-107925607 TATGGTACTATATTGATTTCTGG + Intergenic
1104275625 12:127324672-127324694 TAAGATAAAACACTGATTACAGG - Intergenic
1107198115 13:37679395-37679417 TATGGTAATACATTGATTACAGG + Intronic
1108274734 13:48796391-48796413 TTTGCTAACACATTGATTATGGG - Intergenic
1110644912 13:77871291-77871313 TGAGGTAATACATTTATTTCAGG - Intergenic
1111285512 13:86086595-86086617 TAGGGTATTAAATAGATTACAGG - Intergenic
1111352672 13:87051954-87051976 TATAGTAACACATAAATTACTGG + Intergenic
1118850569 14:69580201-69580223 TGAGGCAATACATTGATGACTGG - Intergenic
1120140495 14:80925443-80925465 AAAGGCAATTCATTGATTACTGG - Intronic
1123175587 14:106415071-106415093 TATAGTAATACACTGAAGACTGG - Intergenic
1125742846 15:41979252-41979274 TCTGGTAACAAATTGATTATTGG - Intergenic
1126604970 15:50467106-50467128 TATTTTAATAAATTGATTACTGG + Intronic
1126883747 15:53127635-53127657 TAAAGTAATACATTGATTTTAGG - Intergenic
1131896815 15:97042347-97042369 TATAGTATTACATTGATTGATGG - Intergenic
1133866782 16:9651421-9651443 TCTGCTAATACCTTGATTTCTGG + Intergenic
1135848778 16:25943276-25943298 AATTGTAATACATTGAATCCAGG + Intronic
1137788305 16:51154375-51154397 GATGGCAATACATCAATTACGGG + Intergenic
1146933775 17:36797253-36797275 AGAGGCAATACATTGATTACTGG - Intergenic
1153169997 18:2304843-2304865 AATGGTAAAACATTCATTTCTGG + Intergenic
1154165744 18:12013177-12013199 TATGTTACTACACTGAATACGGG + Intronic
1155460595 18:26077739-26077761 TATGGAAATACAGTATTTACTGG + Intronic
1155995438 18:32326344-32326366 TATGGTCACAAATTTATTACAGG - Intronic
1158351054 18:56564947-56564969 TATGGTACTATATTGATCCCAGG - Intergenic
1158753306 18:60291469-60291491 TATGTGAATACAGTGATTATGGG - Intergenic
1159156362 18:64588346-64588368 TATGGTAATACTTTTATTGAGGG - Intergenic
1164429395 19:28173789-28173811 AATGGTAATACATTTATGAATGG - Intergenic
1166560084 19:43727046-43727068 TATTGTAACACATTTATGACAGG + Intergenic
925159055 2:1670051-1670073 GATATTAATACATTGATTACAGG + Intronic
925541318 2:4970724-4970746 TATGGAAACACATTGATGTCAGG - Intergenic
926496183 2:13591901-13591923 TTTGGAAATACATTTACTACAGG - Intergenic
929365045 2:41144045-41144067 TATTGTAAGACATTAATAACAGG + Intergenic
931297610 2:60944304-60944326 TATGGTAATCAAATGATCACTGG - Intronic
931639485 2:64369542-64369564 TGTTGGAATACAATGATTACTGG - Intergenic
935381950 2:102461789-102461811 TGAGGTAATACATTGATAACTGG + Intergenic
936231620 2:110706100-110706122 AATCCTAATACATTGCTTACAGG - Intergenic
942393964 2:175526704-175526726 CTTGTTAATACACTGATTACTGG + Intergenic
943991868 2:194706139-194706161 TATGGTTATTTATTGATTATAGG + Intergenic
945458441 2:210076105-210076127 GATGAAAATACATAGATTACAGG + Intronic
947885318 2:233564778-233564800 AATGTTCATACATTCATTACAGG - Intronic
1168957821 20:1846887-1846909 AATGGTAATAAATAGATTAAAGG + Intergenic
1172327229 20:34045742-34045764 TTTGGTAATAGAGTGATTTCTGG + Intronic
1178675688 21:34629757-34629779 TATGGTAAGACTATGTTTACTGG - Intergenic
1179399725 21:41072670-41072692 TATGGGAACACAATGATTAGGGG + Intergenic
1184680192 22:46068430-46068452 TATGATTATACAATGATTTCAGG + Intronic
951343010 3:21511850-21511872 TAGTGAAATACATTAATTACCGG + Intronic
957257331 3:77855338-77855360 TGTGAAAATACCTTGATTACAGG + Intergenic
958000916 3:87747906-87747928 TATGGTTATCAATAGATTACAGG + Intergenic
959652351 3:108763412-108763434 TATGGTAATACTTGGCTAACTGG + Intergenic
963935337 3:151046594-151046616 TGTGGTAATACATAGATTAGTGG - Intergenic
965352695 3:167634083-167634105 AATGGGAACACATTGTTTACTGG - Intronic
965851842 3:173036748-173036770 TATTATAATACATTGAATGCAGG + Intronic
967484121 3:190010305-190010327 CGTGGTAATACATTTATTTCAGG - Intronic
971608651 4:28692142-28692164 CATTGGAATACATTGGTTACTGG + Intergenic
975684928 4:76910231-76910253 AATGGTTATTCATTGCTTACAGG + Intergenic
978568334 4:110109150-110109172 TGTGGTAATACTTTGTATACTGG + Intronic
978811585 4:112855413-112855435 TATGGTAGTACACTGACAACAGG + Intronic
979944445 4:126810543-126810565 TATTGTAAAACACTGAATACAGG + Intergenic
980639277 4:135553896-135553918 TATGGTAATTCAATGATTATAGG + Intergenic
983377042 4:166943268-166943290 TATAGGAAAACATTGATTTCCGG + Intronic
983856157 4:172647833-172647855 AATGGTAATGCATTGATTAAGGG + Intronic
984469454 4:180148332-180148354 TATGGATATACATAGCTTACTGG + Intergenic
987339211 5:16924343-16924365 TAAGGAAATACATTGATTAGCGG - Intronic
994908296 5:105868722-105868744 TAGGGTAACACAATGATTAAGGG - Intergenic
995069808 5:107907069-107907091 TATAGTAATTCATTGATGAATGG + Intronic
999543814 5:152604543-152604565 TCTGGTTATAGGTTGATTACCGG + Intergenic
1000532056 5:162435415-162435437 AATGATAATATGTTGATTACTGG - Intergenic
1002166003 5:177346433-177346455 TATTTTAATAAATTGATTACCGG + Intronic
1004090898 6:12500129-12500151 AATGCTAATACATTGTTGACAGG + Intergenic
1005251184 6:23948329-23948351 TAGGGGAATAGATTGATTTCTGG - Intergenic
1009697112 6:67120796-67120818 TATGGTTATTAATTGATTATGGG + Intergenic
1009785517 6:68333341-68333363 CCTGGTAATACATTAATTACAGG - Intergenic
1016399280 6:143660739-143660761 TATGGAAATACATAAATTAAGGG + Intronic
1016599640 6:145843485-145843507 TATGTTAATAGTTTGGTTACTGG + Intergenic
1016874197 6:148848763-148848785 TATGACAAGAAATTGATTACAGG + Intronic
1018337703 6:162812346-162812368 TATTGTAGAACACTGATTACTGG - Intronic
1018456476 6:163958249-163958271 TAGGGTCATACAGTGCTTACCGG + Intergenic
1021051892 7:15995600-15995622 AATGGTCATACATAAATTACTGG - Intergenic
1023639714 7:42245256-42245278 TACTGTAATACTGTGATTACAGG - Intergenic
1027726687 7:81814520-81814542 TATGATACTACTTTCATTACTGG - Intergenic
1029955170 7:104631224-104631246 TGAGGTAATAAATTGATAACTGG + Intronic
1030477490 7:110055026-110055048 TAGGGCAATATATTGAATACAGG + Intergenic
1031047172 7:116904615-116904637 AATTCTAATACATTGATTAAAGG + Intronic
1032286874 7:130544896-130544918 TATGGTAATATATTGATGTTGGG + Intronic
1037144009 8:15551306-15551328 TATGGTAATAGAATGATTTATGG + Intronic
1042703354 8:71640928-71640950 TTTGGGAATGCATTGATTTCTGG - Intergenic
1044269183 8:90220975-90220997 TGTGGTAATTCTTTGTTTACAGG - Intergenic
1046139624 8:110073452-110073474 TATGTTGATATTTTGATTACTGG - Intergenic
1051445127 9:17132298-17132320 AATGCTAATACATTGCTTATGGG + Intergenic
1052417804 9:28200735-28200757 TGTGGTAAGACATAGATGACTGG - Intronic
1052465096 9:28820147-28820169 TTTGGTAATATATTACTTACTGG - Intergenic
1055230254 9:74055024-74055046 TGTCATAATACATTGATTATTGG - Intergenic
1055740903 9:79387992-79388014 AATAATAATACATTTATTACAGG - Intergenic
1055953691 9:81754348-81754370 TATGGTAATAGAATGATTCAGGG + Intergenic
1058384669 9:104420142-104420164 TATGGTAAGACAAAGATTTCTGG - Intergenic
1062026470 9:134342942-134342964 TCTGGTAATCCTTTGATTAGAGG + Intronic
1193839623 X:86393422-86393444 TAACGCAATACATAGATTACTGG + Intronic
1194420885 X:93671852-93671874 TATAGTAATAGATTGATTTCAGG + Exonic
1195547471 X:106128990-106129012 TATAGTAATAAAATTATTACTGG + Intergenic
1196370238 X:114969965-114969987 TTTATTAATTCATTGATTACTGG - Intergenic
1197357369 X:125452215-125452237 TATGGTTTTACTTGGATTACTGG - Intergenic
1198452759 X:136784320-136784342 AGAGGTAATAAATTGATTACAGG - Intergenic
1198944413 X:141994849-141994871 TATGGTAATAGAATGATGAAAGG + Intergenic