ID: 1107199097

View in Genome Browser
Species Human (GRCh38)
Location 13:37691981-37692003
Sequence CTATAGTAACACATTTACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107199096_1107199097 8 Left 1107199096 13:37691950-37691972 CCGTGGCAGTAACATGTTTTTAT 0: 1
1: 0
2: 0
3: 29
4: 268
Right 1107199097 13:37691981-37692003 CTATAGTAACACATTTACCCAGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107199097 Original CRISPR CTATAGTAACACATTTACCC AGG Exonic
912127992 1:106564248-106564270 CTATAGTAATACATTTCACAGGG - Intergenic
918102425 1:181387884-181387906 CTATTGCAACACATTTCCCTAGG + Intergenic
1064694859 10:17954962-17954984 CTATTATAACACATTTCCTCTGG - Intronic
1071216924 10:83415998-83416020 CTATAGTAACCAAATTAACCTGG - Intergenic
1071762637 10:88626343-88626365 CTATAGGAACACATGGACACAGG - Intergenic
1077951969 11:6968908-6968930 TTTTATTAAAACATTTACCCAGG - Intronic
1086725650 11:90180027-90180049 CTACACTAACACATTTTCTCAGG - Intronic
1087583712 11:100091862-100091884 TTGGAGTAACACATGTACCCAGG + Intronic
1090337608 11:125983521-125983543 CTGTAGGAACACCTTTACACTGG - Intronic
1092404393 12:8208411-8208433 ATATGGTATCACATTTAACCAGG + Intergenic
1096755591 12:53796753-53796775 ATACAGTAACTCATTTATCCAGG - Intergenic
1103881104 12:124166660-124166682 CTAGGGTAACACATTTCTCCTGG - Intronic
1104529481 12:129555376-129555398 CTACAGAAACAGAATTACCCTGG + Intronic
1107199097 13:37691981-37692003 CTATAGTAACACATTTACCCAGG + Exonic
1108389166 13:49930850-49930872 CTAAATTAACTAATTTACCCAGG + Intronic
1110349541 13:74491291-74491313 CTACAGTCACTCATGTACCCTGG + Intergenic
1113448851 13:110391440-110391462 CTATGATAAAACATTTACACTGG - Intronic
1115507095 14:34103024-34103046 CTATAATAAAACATTTTCCTGGG - Intronic
1138517301 16:57543243-57543265 CTATAGTAACCCTATTTCCCAGG - Intronic
1141983841 16:87566721-87566743 CTCTATTAACCCATTAACCCAGG - Intergenic
1155094963 18:22546722-22546744 TTATAGTAACAAATTTGCCAAGG - Intergenic
1155698363 18:28711788-28711810 CCATAGCAACAAATTTACCATGG - Intergenic
1157226075 18:45865938-45865960 CTATGGTAACACTTTGACCAGGG + Intronic
1158299059 18:56032204-56032226 CCATAGATACACATTTACCTAGG - Intergenic
1160166602 18:76518444-76518466 CAATAGTACCACATTTTCTCTGG + Intergenic
1162282580 19:9711056-9711078 CTAAAGTTACAAAATTACCCAGG + Intergenic
1165676816 19:37733160-37733182 TTATAGTATCACAGTTATCCAGG + Intergenic
931140319 2:59450812-59450834 CTATACTAACAAATTAACCTTGG - Intergenic
933325932 2:80837067-80837089 TTTTAGTAACACATTTTCCAAGG + Intergenic
937255321 2:120551435-120551457 CTATCTTAACACATTTTGCCAGG - Intergenic
939541527 2:143500314-143500336 CTACAGTAACACATTAAGGCAGG + Intronic
944917515 2:204376240-204376262 CTATCTTAACACATTTAACCTGG + Intergenic
1174913561 20:54632184-54632206 CTATAGTAACATCTTAACTCAGG + Intronic
1176964814 21:15200369-15200391 CTATAGTAACACTTGAATCCTGG + Intergenic
949429453 3:3958819-3958841 CTATAGTAACAGATTTTACAAGG - Intronic
957577152 3:82023135-82023157 CAATAATAACACATTTATCAAGG + Intergenic
963862555 3:150325716-150325738 CTATAGAGACAGATTTACCAAGG + Intergenic
966145766 3:176810179-176810201 ATACAGTACCACATTTACCAAGG + Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
974382203 4:61155274-61155296 CCCTTTTAACACATTTACCCTGG - Intergenic
975201900 4:71600758-71600780 AAATTGTAACACATTTCCCCAGG - Intergenic
978121561 4:105085579-105085601 CTTAAGTAAGACATTTGCCCAGG - Intergenic
978828022 4:113048038-113048060 CAATAGCAACACATTTACATAGG + Intronic
982593445 4:157347258-157347280 CCAAAATAACACATGTACCCTGG - Intronic
990809984 5:59712924-59712946 TTATAGTAAAACATTTATACTGG - Intronic
993104466 5:83583452-83583474 CTTTAGTAATACAGCTACCCTGG - Intergenic
993998867 5:94754749-94754771 CCACAGTAACACAATTACCTAGG + Intronic
994488315 5:100408169-100408191 TTATCGTAACACATTTATCCAGG - Intergenic
994941472 5:106329030-106329052 CTGTATTAACAATTTTACCCAGG - Intergenic
1000765364 5:165282885-165282907 AAATAGTAACATATTTACCTAGG - Intergenic
1000951365 5:167487183-167487205 CTAAAGTGACACAAATACCCAGG - Intronic
1003767042 6:9249573-9249595 CTGTAGCAACACATTTACATAGG - Intergenic
1008774052 6:55013646-55013668 CTGTAGTAATACATTTACTATGG - Intergenic
1010471067 6:76229324-76229346 CTCTATAAACACATTTTCCCAGG + Intergenic
1012103062 6:95116068-95116090 CTGTAGTAACACACATCCCCAGG - Intergenic
1012256383 6:97037782-97037804 CTATAGTAACTAAATTAGCCTGG + Intronic
1024126016 7:46295256-46295278 CTAAAGTAATAGATTTAACCAGG + Intergenic
1031241274 7:119243723-119243745 CTATATGAACACATTTACTGGGG + Intergenic
1032618753 7:133504760-133504782 CAATAATAACACAGTTACCCCGG - Intronic
1034057244 7:148048238-148048260 TTTTAGTAACACATTGACCTGGG + Intronic
1038951614 8:32421196-32421218 CTATAGTAAAGGATTTAGCCAGG - Intronic
1039136510 8:34329981-34330003 GTATAGTAAGTCATTTACCTAGG - Intergenic
1039827134 8:41184134-41184156 CTGTAGTATCCCATTTACTCAGG + Intergenic
1043528989 8:81129096-81129118 CTAAAGAAACAGATTTTCCCTGG - Intergenic
1046700700 8:117397439-117397461 CTATATTCACACTTTTACCATGG - Intergenic
1051469279 9:17418048-17418070 CAAAAGTAAGACATTTACCTTGG - Intronic
1057388860 9:94626595-94626617 CCCGAGTAACACATTTACACAGG + Intronic
1058164815 9:101607387-101607409 CTATAGCAACAGACTTACACAGG + Intronic
1058389293 9:104476442-104476464 CCATAGTAACAGAGTCACCCAGG + Intergenic
1193766853 X:85540119-85540141 TTCTAGTAAAACATTTAACCGGG + Intergenic
1194481320 X:94428647-94428669 CTTTAGTAACATATTTATCTTGG - Intergenic
1195772196 X:108363394-108363416 ATATAATACCACATTTGCCCTGG + Intronic
1196466949 X:115982626-115982648 CTATAGTGACACATTTTCTAGGG + Intergenic