ID: 1107199179

View in Genome Browser
Species Human (GRCh38)
Location 13:37693181-37693203
Sequence ACTGACAATCCCAATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107199179_1107199180 20 Left 1107199179 13:37693181-37693203 CCTTTCTCATTGGGATTGTCAGT 0: 1
1: 0
2: 1
3: 8
4: 157
Right 1107199180 13:37693224-37693246 AGAAAATTGTATCTTTCAGATGG 0: 1
1: 0
2: 2
3: 48
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107199179 Original CRISPR ACTGACAATCCCAATGAGAA AGG (reversed) Intronic
904340200 1:29829360-29829382 AGTGACTGTACCAATGAGAATGG + Intergenic
906120039 1:43383435-43383457 ACTGACATTTCCAGTGGGAAGGG + Intergenic
906759493 1:48362568-48362590 ACTCACAATCCAGATGAGACAGG + Intronic
907737927 1:57133801-57133823 ACTGTCATTCCAAATGATAAAGG + Intronic
913327881 1:117643370-117643392 ACTCATAATTACAATGAGAATGG - Intergenic
915504943 1:156348544-156348566 AAAGACAATCCAAAGGAGAAGGG + Intronic
917608936 1:176666830-176666852 ACTGAAAATCTTAATGAGATTGG + Intronic
917716183 1:177740311-177740333 ACTGTAAATCCCAGTGAGCAAGG - Intergenic
917979399 1:180259796-180259818 AGTGACAAGCCCAAGGGGAAGGG + Intronic
920999332 1:211026713-211026735 TCTGACCATCCCATTGAGGAGGG - Intronic
923406562 1:233666790-233666812 AGTGACAAACCCAAGGAGCACGG - Exonic
924110439 1:240693540-240693562 AGTGAGAAACCCAACGAGAAGGG - Intergenic
924201766 1:241667707-241667729 ACCAACAATCCCAATGAGCTTGG + Intronic
1063262984 10:4411114-4411136 ACTGACTATCCCATTGAGAGTGG - Intergenic
1063769327 10:9179810-9179832 ACAGAGAATCCCACTGTGAAGGG + Intergenic
1064224082 10:13467150-13467172 ACAGCTGATCCCAATGAGAAGGG - Intronic
1065060886 10:21899521-21899543 ACAGACAGTCCAAATGAGAAAGG + Intronic
1068960813 10:62864556-62864578 ACAGACAATAACAATGAGACAGG - Intronic
1070672621 10:78388650-78388672 ACTCAGAACCCCAAAGAGAAGGG - Intergenic
1071998720 10:91172826-91172848 CCTGACATTCCCAGTGAGGAAGG - Intronic
1074671177 10:115793791-115793813 ATTGATAATCCCAATGAGTGTGG + Intronic
1080427963 11:32173479-32173501 GCTGACAATCCCAAAATGAAAGG + Intergenic
1081050452 11:38333410-38333432 ACTGACTATCAAAATGGGAAGGG + Intergenic
1084343133 11:68522285-68522307 ACTGCCAATCTGTATGAGAATGG + Intronic
1091140011 11:133226937-133226959 ACTATCAATCCCAGTGAGACTGG - Intronic
1096873423 12:54609081-54609103 ATTTACCTTCCCAATGAGAAGGG + Intergenic
1097739370 12:63221092-63221114 ATTGCCAACCCCATTGAGAAAGG - Intergenic
1107199179 13:37693181-37693203 ACTGACAATCCCAATGAGAAAGG - Intronic
1107572738 13:41680385-41680407 AATGAAAATCCCTATGAGCATGG - Intronic
1107761370 13:43683064-43683086 GCTGACAATTCCAAAGATAAAGG - Intronic
1108462600 13:50682093-50682115 ACTGTCAATGACAAAGAGAAAGG + Intronic
1109369427 13:61402471-61402493 ACTGACAATCTGAATGAGCTTGG - Intergenic
1110061310 13:71041337-71041359 ACTGACAATACCAAAGACACTGG + Intergenic
1111340831 13:86883160-86883182 ACTCACAGTCCCAGGGAGAAGGG - Intergenic
1112205157 13:97317063-97317085 CCTGACAATGCCAGTGGGAACGG + Intronic
1115858494 14:37657520-37657542 ACTGAATATCCTAATGTGAATGG + Intronic
1117047390 14:51827170-51827192 AATCACAATCCCTAGGAGAAGGG + Intronic
1117893739 14:60455273-60455295 AGTGACAATCCTATCGAGAAAGG + Intronic
1118156923 14:63251527-63251549 GCAGACAAACCCAAAGAGAAAGG + Intronic
1121726988 14:96159492-96159514 ACAGAGAATCCTAATGAGTAAGG + Intergenic
1123869847 15:24559535-24559557 ACTGACTATGTCAATGAAAATGG - Intergenic
1127400072 15:58576568-58576590 ACAGACATCCCCAAAGAGAAGGG + Intergenic
1128616257 15:69112663-69112685 GCTGACAATGCCACTCAGAATGG + Intergenic
1130300362 15:82675983-82676005 ACTGTCATTCCCAAGGTGAAAGG - Intronic
1131752684 15:95526437-95526459 AATGTTAATCCCAATGACAATGG - Intergenic
1132237323 15:100232107-100232129 ATTGACACTTCCAATGAGATAGG + Intronic
1135837165 16:25836932-25836954 ACTGGCCATCGTAATGAGAAAGG + Intronic
1138366368 16:56481246-56481268 ACAGACAATCCCAAGCAGAGCGG + Intronic
1139151956 16:64392853-64392875 ACTGACAATTCCCATTGGAAAGG + Intergenic
1139396528 16:66644151-66644173 TCTGACAATCCCAAATAAAATGG + Intronic
1139826865 16:69764034-69764056 ACTGACCATCCCAATTTCAAAGG - Intronic
1140341772 16:74171780-74171802 ACTGGTATGCCCAATGAGAAGGG + Intergenic
1140703615 16:77605625-77605647 TCTGGTAATCCCAATGAAAAAGG - Intergenic
1142703039 17:1676054-1676076 ACTGACAAAAGCAATGGGAAGGG + Exonic
1146786221 17:35724256-35724278 ACTGAAAATCCAAATGACCAGGG - Intronic
1146972087 17:37081653-37081675 ACTGACAATGCCAGTGGGCATGG + Intergenic
1147062104 17:37888497-37888519 ACTGTCAGTCACAGTGAGAAGGG + Intergenic
1147210012 17:38867521-38867543 ACTGAAATTACCAATGAGGAAGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1165889641 19:39103146-39103168 ACAGAAAATCCCCATTAGAATGG - Intronic
927996825 2:27492715-27492737 AACAACAATCCCAAGGAGAAGGG - Exonic
930355946 2:50320166-50320188 CCTAACAATTCTAATGAGAAGGG + Intronic
932512985 2:72313979-72314001 ACTGAGAACCACATTGAGAAAGG + Intronic
933166663 2:79083961-79083983 GCTGACAATCACCATGACAATGG - Intergenic
934962133 2:98685650-98685672 ACAGACAATTCTAATTAGAATGG + Intronic
936162352 2:110094179-110094201 AGTGTCAATCCCAGTGACAAGGG + Intronic
936182308 2:110277187-110277209 AGTGTCAATCCCAGTGACAAGGG - Intergenic
937468822 2:122157921-122157943 ACCAACAAGCCCAATGAGGAAGG - Intergenic
938215331 2:129507883-129507905 ACTGACAAGCATAATGAGATTGG + Intergenic
939849421 2:147286635-147286657 AAAGAAAATCCCAGTGAGAATGG + Intergenic
941238620 2:163009222-163009244 ATTTACAAGCCCAATAAGAAGGG - Intergenic
942982990 2:182104996-182105018 ACTGACAATGCAAAAGAGAGTGG + Intronic
943030940 2:182684920-182684942 TCATACATTCCCAATGAGAAAGG + Intergenic
944161092 2:196661057-196661079 AATGGCAATCCAAAGGAGAAAGG - Intronic
947795197 2:232890122-232890144 CCTGACAACCCCAGTGAGACAGG - Intronic
948006576 2:234614117-234614139 ACAGACCCTCCCACTGAGAAGGG + Intergenic
1172757820 20:37299634-37299656 TCTGCCCATCCCAATGATAAAGG - Intronic
1173829435 20:46071443-46071465 ACTTACAAATCCAATGGGAATGG - Intronic
1177487542 21:21778329-21778351 AATGACAATCCCCAAGACAATGG - Intergenic
1178130178 21:29563379-29563401 ATTGAAAATCCCCCTGAGAAAGG + Intronic
1179065975 21:38025241-38025263 ACTGACAATGAGAATGAAAAAGG - Intronic
1184756407 22:46518447-46518469 ACTGCAGATCCCACTGAGAAGGG + Intronic
955457849 3:59143948-59143970 ACTGAGTATGCCAATGGGAATGG + Intergenic
956725446 3:72152897-72152919 ATGGACAGTCCCAAAGAGAATGG + Intergenic
957433498 3:80144836-80144858 AAAGACCATCCAAATGAGAAAGG - Intergenic
957458523 3:80486459-80486481 ACTGAAAATATAAATGAGAAAGG + Intergenic
957855408 3:85870015-85870037 ACTGCCAATCCCAATGTGTATGG + Intronic
959662016 3:108879546-108879568 CCTGAAAATGCCAATGAGCACGG + Intergenic
962166369 3:133053331-133053353 ACAGACAATCCAAGGGAGAAAGG + Intronic
962349722 3:134647907-134647929 ACCGTCAATCCCAATGGGAATGG + Intronic
963494554 3:146043029-146043051 AATGATAATCCCAAAGACAAAGG - Intergenic
967379348 3:188840376-188840398 ATTGACACTCCCAAGGATAAGGG + Intronic
969039456 4:4283951-4283973 ACTAACATTAACAATGAGAATGG + Intronic
969138661 4:5051096-5051118 ACTGCCCATCCCAATATGAATGG + Intergenic
970060496 4:12027678-12027700 AATGGCAATCACACTGAGAAAGG - Intergenic
970303348 4:14704367-14704389 ACTGTGAATGCCAAAGAGAAAGG - Intergenic
972804438 4:42513720-42513742 GCTGACAATCCCAAAGGCAAGGG + Intronic
974782759 4:66574979-66575001 ACTGACTATCCAAAGGACAAAGG - Intergenic
975145241 4:70959837-70959859 ACTGAGTATGCCACTGAGAAAGG - Intronic
975454312 4:74572214-74572236 GCTGACAATCCAAATGATAAAGG + Intergenic
975679972 4:76866957-76866979 ACAGACAATCCAGATGAGGAAGG + Intergenic
976519335 4:86007941-86007963 ACTGATAATGCAAAAGAGAAAGG - Intergenic
976876462 4:89859144-89859166 ACTGACAATACAAATGTTAAAGG + Intergenic
979353046 4:119668582-119668604 ACTGCAAAGCCCAAAGAGAAAGG + Intergenic
980179494 4:129386666-129386688 ACCAACAATGCCACTGAGAAGGG + Intergenic
984790448 4:183610098-183610120 ACTCAAAATCCCAAAGAGAGAGG + Intergenic
984859671 4:184226706-184226728 ACTGAAAATTTCAATGAGCAAGG + Intergenic
986436552 5:7738207-7738229 ACTGAGAATTCTTATGAGAATGG + Intronic
986700611 5:10404650-10404672 GTTGACAATTCCAGTGAGAAGGG + Intronic
987169231 5:15236621-15236643 TCAGACAAACCCACTGAGAATGG - Intergenic
989185654 5:38623059-38623081 AATGTCACTCCCAATCAGAAAGG + Intergenic
991150981 5:63369621-63369643 ACTGCATATCCAAATGAGAATGG + Intergenic
992154412 5:73940704-73940726 ATGGCCAAGCCCAATGAGAAAGG - Intronic
993784449 5:92111360-92111382 ACTGACCATCTCAATGTCAAAGG - Intergenic
994108238 5:95970221-95970243 TCTGCCATTCCCAATGAGTAAGG - Intergenic
994282625 5:97924033-97924055 ACTGAAACTCACTATGAGAATGG + Intergenic
995022614 5:107383092-107383114 ACATCCATTCCCAATGAGAAAGG + Intronic
995400144 5:111731739-111731761 CCTCACAATCCTGATGAGAAAGG + Intronic
997944028 5:138183342-138183364 AATGGCAATCCCTATGTGAAAGG + Exonic
998618877 5:143772543-143772565 CCTTACAATCACAATGAGATTGG + Intergenic
998698523 5:144669106-144669128 ACTGACAATTCCAATGGGAATGG + Intergenic
998927619 5:147143375-147143397 ACTGACAAACACATTGAGAATGG + Intergenic
1002379644 5:178817430-178817452 AATGACGAACTCAATGAGAAAGG + Intergenic
1002511341 5:179720498-179720520 ATTGACAACCCCAATTATAAAGG + Exonic
1002881538 6:1256858-1256880 ACTGCCCATCCCAATGAGCTGGG + Intergenic
1003963277 6:11229175-11229197 ACTTACAATGCCATTAAGAAAGG - Intronic
1006727163 6:36207763-36207785 ACTGATGATGCCCATGAGAATGG - Intronic
1009513234 6:64579694-64579716 ACTGAGAATATGAATGAGAATGG - Intronic
1009566282 6:65314849-65314871 ACTAACAATCCCATACAGAAGGG + Intronic
1011084169 6:83520599-83520621 AATGACAATACCAATGATATAGG - Intronic
1011878001 6:91986052-91986074 ATTGACCATCAGAATGAGAATGG + Intergenic
1013159666 6:107529991-107530013 AATCACATTCCCAAAGAGAACGG - Intronic
1013587713 6:111594424-111594446 ACTGGAAAACCCAGTGAGAATGG - Intronic
1021466697 7:20952421-20952443 ACTGACAATCACAGGGAGAATGG + Intergenic
1023544072 7:41298555-41298577 ACAGATGCTCCCAATGAGAATGG - Intergenic
1023776475 7:43612543-43612565 ACTGATAATCCCAATATGTATGG + Intronic
1027341791 7:77216536-77216558 ACTGACAATTCCATTAAGAGGGG - Intronic
1028178810 7:87691731-87691753 ACTGACAACCCCAGAAAGAAGGG - Intronic
1028829231 7:95308877-95308899 ACAGAGAATCCTAATCAGAAAGG - Intronic
1037344692 8:17886394-17886416 ACTGACAAAGTCAAAGAGAAAGG + Intronic
1037477110 8:19268792-19268814 ACTGATCATGCCATTGAGAATGG + Intergenic
1037493740 8:19419637-19419659 ACTGCCAACCCTAAAGAGAAAGG - Intronic
1037778950 8:21854773-21854795 ACTCACCACCCCAGTGAGAATGG + Intergenic
1038134325 8:24769273-24769295 GCTGACTATCCAAATGAAAATGG - Intergenic
1039358554 8:36848762-36848784 ACTGAGAATCCATATGAAAAGGG + Intronic
1039818772 8:41118098-41118120 ACTGCCCATCCCATTCAGAAAGG + Intergenic
1042111660 8:65387657-65387679 GCTGTCAATGCCAAGGAGAAAGG + Intergenic
1042381165 8:68115817-68115839 ACAGACAGTGACAATGAGAAGGG + Exonic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1049484615 8:142848622-142848644 ACTGCCAGTCCCAAAGAGAGAGG + Intronic
1051314696 9:15817100-15817122 ACAGCCAATGCCAATCAGAATGG - Intronic
1052102183 9:24461775-24461797 TCAAACAATCCCAATGATAAAGG - Intergenic
1055191670 9:73531881-73531903 ACTGACAATCTCATTGAAAGAGG - Intergenic
1056034339 9:82587492-82587514 CCTGGCAATCCCAATGGGCAGGG + Intergenic
1059467183 9:114476390-114476412 ACTGAAAATCCCAAGCAGCAAGG - Intronic
1186092317 X:6063062-6063084 AATGACAACCTCAATGAAAAGGG - Intronic
1187157983 X:16738804-16738826 ACTTACAATGACCATGAGAAGGG + Intronic
1188819469 X:34756112-34756134 ACAGAAAACCTCAATGAGAATGG + Intergenic
1191062421 X:56313612-56313634 ACTGACAACACCCATGAGAAAGG + Intergenic
1191690851 X:63936307-63936329 AGAGAAAATCCCAAGGAGAAGGG - Intergenic
1192589967 X:72351540-72351562 AATGACAATCCCAACCAGAGTGG + Intronic
1193325032 X:80170305-80170327 ACTAACAAGCACAATGAGATTGG - Intergenic
1194528836 X:95017404-95017426 CCTGAAAATCCAAAAGAGAAGGG + Intergenic
1194976273 X:100399689-100399711 ACTGGCAAACCCATTCAGAAAGG - Intronic
1195488603 X:105439764-105439786 ACAGAAAATATCAATGAGAATGG + Intronic
1196125517 X:112094648-112094670 ACTGAAAATACCAGGGAGAAAGG + Intergenic
1201475506 Y:14377001-14377023 ACTGACAAGCCAAATCAAAATGG - Intergenic