ID: 1107200043

View in Genome Browser
Species Human (GRCh38)
Location 13:37704194-37704216
Sequence TTGCCTACGGGGGAATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107200043 Original CRISPR TTGCCTACGGGGGAATGGGG AGG Intronic
900802756 1:4747508-4747530 GTGCCTAGGAGGGAAGGGGGCGG - Intronic
901724616 1:11231051-11231073 TGGCCTGCGTGGGAAAGGGGAGG + Exonic
902984633 1:20148171-20148193 TCACCTACAGGGGGATGGGGTGG - Exonic
903827841 1:26158245-26158267 TTGCCTGCTGGGGAGAGGGGAGG + Intergenic
906078327 1:43068168-43068190 TTCCCTTTGGGGGAAAGGGGAGG + Intergenic
906530597 1:46521578-46521600 TTGCCTGATGAGGAATGGGGTGG - Intergenic
906723312 1:48024968-48024990 TTGCTTTAGGGGGGATGGGGTGG - Intergenic
907043779 1:51286752-51286774 TTCCCTACGGGGAAATGGTTAGG + Intergenic
908318025 1:62953661-62953683 TTGTCTACGTGGGAATGGCTCGG + Intergenic
908366753 1:63432804-63432826 TTGCCTAGGCGGGAGTGCGGTGG + Intronic
908951091 1:69564135-69564157 TTGTGTGTGGGGGAATGGGGTGG + Intergenic
911600295 1:99841091-99841113 TTGCCTACGGTGGAGTGCAGTGG - Intergenic
913706431 1:121428861-121428883 TTTCCTATAGGGGTATGGGGAGG - Intergenic
917692459 1:177483302-177483324 TTGCCTAGGCTGGAATGTGGTGG - Intergenic
919712411 1:200740210-200740232 TTGCTCACTGGGGGATGGGGGGG - Intronic
921906238 1:220498208-220498230 TTGCCAAGTGGGGAATGGGGTGG + Intergenic
1064254843 10:13734567-13734589 TTGCAGACGGAGGAATGGGGCGG - Intronic
1066082911 10:31949834-31949856 TTGCCTAGGCTGGAATGGAGTGG + Intergenic
1074277661 10:112019594-112019616 TTGCCTACGTTGGAGTGCGGTGG - Intergenic
1076667101 10:132099550-132099572 CTGTCTACGGGGGTTTGGGGAGG + Intergenic
1076820147 10:132934262-132934284 TTGCCTTCGTGGGCACGGGGTGG - Intronic
1077266262 11:1652179-1652201 ATGCCTCCGGGGGCATGCGGTGG - Intergenic
1077300241 11:1843341-1843363 GTGCCTACTGGGAAAGGGGGCGG + Intergenic
1078125442 11:8557209-8557231 TTGCCTACGGTGGAGTGCAGTGG - Intronic
1080074591 11:28134371-28134393 ATACGCACGGGGGAATGGGGTGG - Intronic
1081340890 11:41926181-41926203 TTGCCTGCAGGGGAGTTGGGGGG + Intergenic
1083034075 11:59620334-59620356 TTGCCACCTGGGGACTGGGGAGG + Intergenic
1083859233 11:65411223-65411245 TTGCCTGCGAGGGAATGGGAGGG - Exonic
1084409322 11:68997254-68997276 CTGCCTACGGAGGGATGGGGAGG + Intergenic
1085698729 11:78727933-78727955 ATGGCAACGGGGGAATGGGCTGG + Intronic
1087177194 11:95106822-95106844 ATGCTGACGGGGGAAAGGGGGGG - Intronic
1088857138 11:113766323-113766345 TTGCCTAGGCTGGAGTGGGGTGG - Intronic
1088924480 11:114286415-114286437 TTGCCTGTGGGTGACTGGGGAGG - Intronic
1090767565 11:129889836-129889858 TTACCTGTGGGGGAATGGAGAGG + Intronic
1092358320 12:7815374-7815396 TTGCCCACGGTGGAATGCAGTGG - Intronic
1096056911 12:48660887-48660909 TTGCTTAAGGGAGAATGGGATGG - Intronic
1096982773 12:55737905-55737927 GTGCCTCTGGGGGAGTGGGGAGG - Intergenic
1098558684 12:71848195-71848217 TTGGATACCTGGGAATGGGGTGG + Intronic
1099354104 12:81611703-81611725 ATGCCTCTGGGGGAGTGGGGAGG + Intronic
1100269766 12:93013785-93013807 TTGCCTAGGCTGGAATGTGGTGG - Intergenic
1102124586 12:110469547-110469569 TTGCCTAGGCTGGAATGCGGTGG + Intronic
1102581673 12:113892391-113892413 TTGCCCAGTGGGGACTGGGGTGG + Intronic
1104561969 12:129853874-129853896 TTGCCTGTGGGGGGATGGAGTGG - Intronic
1107200043 13:37704194-37704216 TTGCCTACGGGGGAATGGGGAGG + Intronic
1114924945 14:27384336-27384358 CTGCCTGCTGGGGTATGGGGGGG + Intergenic
1114977225 14:28116992-28117014 TGGAATATGGGGGAATGGGGGGG + Intergenic
1115764337 14:36607396-36607418 TTGACTTGGAGGGAATGGGGAGG - Intergenic
1119801179 14:77446849-77446871 TTGCCTAAGCTGGAATGGAGTGG + Intronic
1202863832 14_GL000225v1_random:102780-102802 CTGCCTACAGGGGAATTGTGAGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1123821018 15:24030677-24030699 TTGTCTACAGTGGAATTGGGTGG + Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1125430616 15:39589650-39589672 TAGCCTCAGGGAGAATGGGGAGG + Intronic
1125959858 15:43820643-43820665 TTGCCTAGGGTGGAGTGCGGTGG + Intronic
1127614744 15:60673001-60673023 TAGCCTACGAGGGATTGGTGTGG - Intronic
1128795391 15:70462918-70462940 GTGCCTCCGGAGGCATGGGGTGG - Intergenic
1131499996 15:92952934-92952956 TGGCCTGCAGTGGAATGGGGTGG + Intronic
1134650471 16:15904575-15904597 CTGCCAAGGGGGGAATGGTGAGG - Intergenic
1135648743 16:24187033-24187055 TTGTCTACGGGGGCCTGTGGAGG - Intronic
1135708132 16:24692671-24692693 TTGCCTAGGTGGGAATGCAGTGG - Intergenic
1139550798 16:67671941-67671963 TTGCCTAGGCTGGAATGGAGTGG - Intergenic
1140506763 16:75478502-75478524 TTGCCTACTTGGGGAGGGGGAGG + Exonic
1148859129 17:50594974-50594996 TTTCCTACAGGGAAAGGGGGAGG - Exonic
1149920635 17:60655739-60655761 TTGCCTAGGCTGGAATGTGGTGG + Intronic
1151797090 17:76353616-76353638 TGGCCGGCGGGGGAACGGGGCGG + Exonic
1155028044 18:21960195-21960217 TTGCAGAAGGGGGAAAGGGGTGG - Intergenic
1156900534 18:42295830-42295852 TTGCCTAGGGTGGAGTGTGGTGG + Intergenic
1157792932 18:50549082-50549104 TTGCCTAAGTTGGAATGGAGTGG + Intergenic
1159080184 18:63727360-63727382 TGGCCTATGGGCAAATGGGGAGG + Intergenic
1161417627 19:4156542-4156564 TTGCCTAGGGTGGAGTGCGGTGG + Intronic
1163134940 19:15303391-15303413 TTGCCTATGCGGGGATGGGGCGG + Intronic
1166642906 19:44509899-44509921 TTGCCTAGGAAGGAATGGAGAGG + Intronic
1168036926 19:53727394-53727416 TTGCCTACGGTGGAGTGCAGTGG + Intergenic
925138224 2:1534177-1534199 TTGCACACGGGGGATTTGGGAGG - Intronic
927215658 2:20666814-20666836 TTCTCTGCGGGGGAGTGGGGAGG + Exonic
931282479 2:60806478-60806500 TTGCCTAGGCTGGAATGTGGTGG - Intergenic
932398164 2:71462335-71462357 GTGGCTACTGGGGAATGTGGTGG + Intronic
934854890 2:97723631-97723653 TTGCCTTCGGGAGGACGGGGTGG + Intronic
936008581 2:108910529-108910551 TTGTCTGCAGGGAAATGGGGAGG + Exonic
938877555 2:135548584-135548606 TTGCCTCTTGGGGTATGGGGTGG - Intronic
942822012 2:180125405-180125427 TTGCCTAGGGTGGAATGCAGTGG - Intergenic
946028229 2:216685239-216685261 TTGCCCAGGGGGGAATGTAGTGG - Intronic
947168435 2:227286553-227286575 TTACATACGGGGAAATAGGGAGG + Intronic
1170740377 20:19050850-19050872 TTGGGGACCGGGGAATGGGGTGG - Intergenic
1170953986 20:20961809-20961831 TTGCCTACTGGGAAAAAGGGGGG + Intergenic
1171773411 20:29344947-29344969 TTGCCAATGGGGGAAGGGGTGGG - Intergenic
1173341931 20:42160849-42160871 TTGCCTTCGGGGGATGGGAGCGG + Intronic
1174589759 20:51635695-51635717 TTGCCTAGGGTGGAGTGCGGTGG - Intronic
1175812565 20:61866424-61866446 TGGCCTCCGGGGGGAGGGGGAGG - Intronic
1179324280 21:40324459-40324481 ATGCCTAAAGGGGAATGTGGTGG + Intronic
1180318899 22:11303075-11303097 TTGCCAATGGGGGAAGGGGTGGG - Intergenic
1181179491 22:21056834-21056856 TTGCCTGCTGGGGAGAGGGGAGG - Intronic
1184176471 22:42792182-42792204 GTGCCTACGGGAGGAGGGGGAGG + Intergenic
1185188498 22:49417824-49417846 TATCCTACAGGGGAGTGGGGAGG + Intronic
951816214 3:26757824-26757846 TGGCCTACTGGGGAGTTGGGTGG + Intergenic
952508004 3:34024980-34025002 TTGCATACTGGGGAAAGTGGGGG + Intergenic
955159145 3:56447183-56447205 TTGGCCACGGGGGACTGGGTTGG + Intronic
957604388 3:82378489-82378511 TTGCCTATGGCAGAGTGGGGAGG + Intergenic
961817706 3:129559780-129559802 TGCCCTGCGGGGGAGTGGGGTGG + Exonic
962519969 3:136189257-136189279 TTGCCTAGGCTGGAATGTGGTGG - Intronic
964659649 3:159106151-159106173 TTGACTACAGGGGAATGAGAGGG + Intronic
964976413 3:162625664-162625686 TTGCTTACGGAGGAATGCTGAGG - Intergenic
967395198 3:189000786-189000808 TTGCCTAGGCTGGAATGTGGTGG + Intronic
967746091 3:193056995-193057017 TTGCCCACGCTGGAATGCGGTGG - Intergenic
978759259 4:112337661-112337683 TTGCCTAGGCTGGAATGGAGTGG - Intronic
978793332 4:112684961-112684983 TTGCCCAGGGTGGAATGCGGTGG - Intergenic
981000650 4:139825647-139825669 CTGGATACAGGGGAATGGGGAGG - Intronic
982062981 4:151623369-151623391 ATGCCTGGGAGGGAATGGGGAGG + Intronic
984172746 4:176380707-176380729 GTGCACACGGGGGAGTGGGGCGG + Intergenic
989971238 5:50527074-50527096 TTTCCTAAAGGGGTATGGGGAGG + Intergenic
991564055 5:67986090-67986112 TTGCCCAAGGGGGTCTGGGGAGG + Intergenic
992346787 5:75887367-75887389 TTGGTTACGGGGGGCTGGGGTGG - Intergenic
993756202 5:91733478-91733500 TGGCCTATGGTGGAATTGGGAGG + Intergenic
994714377 5:103304409-103304431 ATGACTACAGGGGAAGGGGGAGG - Intergenic
997473099 5:134127626-134127648 TTTCCCACGGGGGAATAAGGTGG - Intronic
997714392 5:136031037-136031059 TTGCCTGCAGGGGTATGGTGGGG - Intronic
999726209 5:154440378-154440400 TTGCCAAGGCTGGAATGGGGTGG - Intergenic
1000359798 5:160436351-160436373 TGTCGTACTGGGGAATGGGGTGG + Intergenic
1003531408 6:6940366-6940388 GAGCCCACGGGGGAAGGGGGTGG - Intergenic
1007736446 6:43985165-43985187 TGGCCAGCTGGGGAATGGGGCGG - Intergenic
1009445039 6:63732719-63732741 TTGCCTATGGTGAAATAGGGAGG - Intronic
1013450104 6:110272120-110272142 TTGTGGACGGGGGAATGGGTGGG - Intronic
1013585509 6:111575182-111575204 TTGCCTAGGCGGGAGTGCGGTGG - Intronic
1017271557 6:152513383-152513405 TTGCCTAGGAGGGAATGCAGTGG + Intronic
1018371838 6:163175603-163175625 GTGCATAAGGGGGAGTGGGGAGG + Intronic
1022073015 7:26936450-26936472 TTGCCCAAGCGGGAATGCGGTGG + Intronic
1022537613 7:31107617-31107639 TTGACTTAGGGGAAATGGGGAGG - Exonic
1031917456 7:127576545-127576567 TTGCCTAGGCTGGAATGCGGTGG - Intergenic
1034319674 7:150168704-150168726 TTGGCTACGAGGGGATGTGGAGG - Intergenic
1034773080 7:153798515-153798537 TTGGCTACGAGGGGATGTGGAGG + Intergenic
1035029956 7:155850296-155850318 CTCCCCATGGGGGAATGGGGTGG + Intergenic
1036759060 8:11494354-11494376 TTGCTCACTGGGGACTGGGGAGG + Exonic
1038247150 8:25869388-25869410 TTTCCTAAGGGGGAATGAGGAGG + Intronic
1042242212 8:66675640-66675662 TTGCCTAGGCTGGAATGGAGTGG + Intronic
1042524537 8:69750423-69750445 TTTTCTAACGGGGAATGGGGAGG - Intronic
1052578208 9:30318400-30318422 TTGCCTAGGCTGGAATGTGGTGG - Intergenic
1054759613 9:68992798-68992820 TTGCCTAGGTGGGAATGCAGTGG - Intronic
1057968871 9:99533880-99533902 TTGCCTACTGGAGTATGGGATGG - Intergenic
1203740492 Un_GL000216v2:173233-173255 CTGCCTACAGGGGAATTGTGAGG - Intergenic
1186621636 X:11247101-11247123 TTGCCTAAGGGATAATGGCGAGG + Intronic
1192233215 X:69279862-69279884 TTGCATACGGGGAAGTGAGGAGG - Intergenic
1192941670 X:75919746-75919768 CTGCCTACCGGGGATTGGCGTGG + Intergenic
1193790477 X:85809964-85809986 TTACCAGAGGGGGAATGGGGTGG - Intergenic
1195526877 X:105901461-105901483 ATGCCTTCTGGGGTATGGGGAGG + Intronic
1197503989 X:127278922-127278944 TTGCCCAAGGTGGAATGCGGTGG - Intergenic
1197893572 X:131288567-131288589 TTGCCTACTGGGGGATTGAGGGG + Intronic
1198683339 X:139204268-139204290 CTGCCTACGAGAGAGTGGGGAGG + Intronic
1198698383 X:139368676-139368698 TTGCCCAGGTTGGAATGGGGTGG + Intergenic