ID: 1107200160

View in Genome Browser
Species Human (GRCh38)
Location 13:37705697-37705719
Sequence AGGTAAATATGCATGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107200160_1107200163 22 Left 1107200160 13:37705697-37705719 CCTTCCAGCATGCATATTTACCT 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1107200163 13:37705742-37705764 TGAACTATTTCATAGTCCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107200160 Original CRISPR AGGTAAATATGCATGCTGGA AGG (reversed) Intronic
902797699 1:18810086-18810108 AGTTTAATATGCAGGCTTGAGGG + Intergenic
903054299 1:20624800-20624822 AAGTAGATAAGCATGGTGGAAGG + Intergenic
906727340 1:48053746-48053768 AGGTAAATATGCCTGTGGCAGGG + Intergenic
909033677 1:70571869-70571891 GGGAAAATGTGTATGCTGGAGGG + Intergenic
909633674 1:77792420-77792442 AGGTAAGTGTGCATGGTGCAAGG + Intronic
911215127 1:95184700-95184722 AGGAAAACATGCATGTGGGAAGG - Intronic
916608302 1:166364277-166364299 AGGTAGGCATCCATGCTGGAGGG - Intergenic
917067703 1:171114786-171114808 TGGAAAATATGATTGCTGGAAGG + Intronic
917133672 1:171767139-171767161 AGATAAATATGCATGGTAAATGG + Intergenic
1063287564 10:4707197-4707219 AGTTAAAATTGCATGCTGCATGG - Intergenic
1065457554 10:25922933-25922955 ATGTACATCTGCATGCTGCAAGG - Intergenic
1071246442 10:83770211-83770233 TAGCAAATATGGATGCTGGATGG + Intergenic
1071546495 10:86533954-86533976 AGGGAAATATGCATTGTGGCTGG - Intergenic
1072456741 10:95582820-95582842 AGGTAAAAATCCAGGTTGGAAGG + Intergenic
1073706238 10:105987625-105987647 AAGTAAACATGCTTTCTGGAAGG - Intergenic
1075901470 10:126046179-126046201 AGGTATGTATGCATGCTGGAGGG - Intronic
1076570216 10:131427622-131427644 AGTTAAATATGCAAGCCAGAAGG + Intergenic
1076576956 10:131475709-131475731 AGGTCAGGGTGCATGCTGGACGG + Intergenic
1079533594 11:21484968-21484990 AGGGAAATAGGCAGGCTGGTTGG + Intronic
1080457703 11:32430939-32430961 AGGTAAAGCTGCCGGCTGGAAGG + Intronic
1083449009 11:62729921-62729943 AGGTAATTTTGCATGCTATAGGG + Intronic
1085558972 11:77452694-77452716 AGGTAAATATGCCTTTTGAATGG - Intronic
1085882309 11:80482403-80482425 AAGCAAAAATGGATGCTGGATGG - Intergenic
1086085079 11:82945573-82945595 AGGAGAAAATGCATGCTGAATGG + Intronic
1086268926 11:85035858-85035880 AGCCAAATATGCATGACGGATGG - Intronic
1086753178 11:90525674-90525696 AGTTAAATATCCATACTAGATGG + Intergenic
1087589597 11:100169934-100169956 AGGAAAATATTCTTGTTGGAGGG - Intronic
1088315860 11:108505843-108505865 AGGTAAATATGTGTACTGGAGGG - Exonic
1090878857 11:130815667-130815689 AGGCATATATGCATGGAGGAGGG - Intergenic
1093696310 12:22164637-22164659 AGGTACATATGAATTCTGAAAGG + Intronic
1093768329 12:22991003-22991025 AGGTACATATGCAAGTTGCATGG + Intergenic
1097217757 12:57427747-57427769 ATGTAAATGTGTATGCAGGAGGG + Intronic
1097879033 12:64670751-64670773 AGGTCAATATGGATTTTGGAGGG - Intronic
1100745916 12:97645608-97645630 AGGCACATATGTATTCTGGAAGG + Intergenic
1101802780 12:108036810-108036832 ACGTAAACACACATGCTGGATGG + Intergenic
1105359601 13:19695608-19695630 CGTTAAATATGCATGCTGGTGGG + Intronic
1107200160 13:37705697-37705719 AGGTAAATATGCATGCTGGAAGG - Intronic
1107834139 13:44400026-44400048 AAATAAATGTCCATGCTGGAAGG + Intergenic
1107908899 13:45086821-45086843 GGGTAAATATGAATTTTGGAGGG + Intergenic
1107969512 13:45627831-45627853 AGGGAACTATTCATCCTGGAGGG - Intergenic
1114889780 14:26904543-26904565 AGGTAATAATGGATGCTGGCCGG + Intergenic
1115976587 14:39003676-39003698 GGGTAAATATACCTGCTAGAGGG - Intergenic
1116801563 14:49449631-49449653 GGGTAAATATTCATGCTGTTAGG - Intergenic
1117616021 14:57534671-57534693 AGGTGAAAATGCAAGCTGCAAGG + Intergenic
1119029510 14:71180821-71180843 GGGTACATAGGCATTCTGGAAGG - Intergenic
1121237453 14:92402969-92402991 TGCTAAACATGCAAGCTGGATGG - Intronic
1125595538 15:40883301-40883323 AGGTAAATATGCATGTTAAGTGG + Intergenic
1126323689 15:47451480-47451502 AGATAAATATAAGTGCTGGATGG + Intronic
1126444120 15:48722770-48722792 AGGGAGATAGGCATGCAGGAAGG + Intronic
1127725223 15:61743291-61743313 ATAAAACTATGCATGCTGGAGGG - Intergenic
1127917239 15:63464827-63464849 TGGTAATTATGCAGGCTGGGAGG + Intergenic
1128183957 15:65628287-65628309 AGGGAAATAAGCATCCTTGAAGG - Intronic
1128367646 15:67015738-67015760 ATGTAAATAGCCATGCTCGAGGG - Intergenic
1129792546 15:78350939-78350961 AGGCAAGTAGTCATGCTGGATGG + Intergenic
1131657918 15:94481304-94481326 AGGGAAATAAGGAAGCTGGAAGG - Exonic
1131689222 15:94808547-94808569 ATGTAACTTGGCATGCTGGATGG + Intergenic
1138204267 16:55113474-55113496 AAGTAAAGATTCATCCTGGAAGG - Intergenic
1143746394 17:8997481-8997503 AGGAAATTATGGATGTTGGAAGG + Intergenic
1147727357 17:42574586-42574608 AGGTGAAGAAGCATGATGGATGG + Intronic
1147732211 17:42610676-42610698 AGGGATGTATGAATGCTGGAGGG + Intronic
1147763828 17:42819368-42819390 AGGAAAAAATCCATACTGGAAGG + Intronic
1153172910 18:2336747-2336769 AGGAAATTATTCATTCTGGAAGG - Intergenic
1157076576 18:44473740-44473762 AATCAAATCTGCATGCTGGAAGG - Intergenic
1157085553 18:44577023-44577045 AGGTAAACATGAATTTTGGAGGG + Intergenic
1157650089 18:49319426-49319448 AGGTAATTTTGCAAGCTGAAAGG + Intronic
1159715824 18:71821101-71821123 AGGTAAATGTGTATGTTGTAAGG + Intergenic
1160181316 18:76638966-76638988 AGGGTAATCTGGATGCTGGAGGG + Intergenic
1162286472 19:9742721-9742743 AGGTAAGAATGGATGATGGAAGG - Intergenic
1164426125 19:28143173-28143195 AGATTAAGATGCATGATGGAAGG - Intergenic
1167190695 19:47987148-47987170 TGGTAAACATGAATTCTGGAAGG + Intronic
1168354683 19:55693825-55693847 AAGGAAAACTGCATGCTGGAAGG - Intronic
927433649 2:23048246-23048268 AGGCAAATATGGAAGGTGGAAGG - Intergenic
929758110 2:44784896-44784918 AGGTCACTCTGAATGCTGGATGG + Intergenic
935662142 2:105476045-105476067 AAGTAAAAATGCATGCTGTTTGG + Intergenic
938316132 2:130329953-130329975 TTTTAAATATGCATGCTGCAAGG + Intergenic
938849416 2:135245395-135245417 AGATAATTATACCTGCTGGATGG + Intronic
940271435 2:151895572-151895594 AGGTAAAAATTCAAGCTGTATGG - Intronic
940284716 2:152022660-152022682 AGGTAAACATGCATATTGCATGG - Intronic
940791498 2:158034195-158034217 TGGTAAAAATGCATGCAGGAAGG - Intronic
943581396 2:189687610-189687632 AGGCAAAAATGAATGCTGGCAGG - Intronic
943787020 2:191888853-191888875 ATTTTAATATGCATTCTGGATGG - Intergenic
947875119 2:233462608-233462630 AGGCAAATATGCATGGGGGCGGG - Intronic
1169745992 20:8943383-8943405 AGGGAGATATGGATGCTTGAGGG - Intronic
1171128681 20:22627936-22627958 AGGCCAAAATGGATGCTGGAGGG - Intergenic
1173490141 20:43473157-43473179 GGGTAGATATGCAGGCAGGACGG + Intergenic
1179250654 21:39668594-39668616 AGTGAGATATGCATGCGGGAGGG + Exonic
1181667980 22:24411643-24411665 AGGGAGATATGTATGCAGGAGGG - Exonic
949455308 3:4231777-4231799 AGGTAAATATGTATGCTACATGG + Intronic
949503762 3:4706787-4706809 AGGTAAATAATCTAGCTGGAAGG - Intronic
949914478 3:8948138-8948160 AGGTAAATATGCATGGCTGTTGG - Intronic
950896814 3:16460119-16460141 TGTAAAATATGCATGGTGGAAGG + Intronic
951927194 3:27921448-27921470 ATGAAAAAATGCATGCTGAATGG - Intergenic
952877016 3:37954629-37954651 AAGTAAATATGCAGGGTGGATGG - Intronic
955628021 3:60940700-60940722 AGGAAAATATGTATACTGTAAGG - Intronic
960345176 3:116521790-116521812 AGGTTAGTATGCATTTTGGAAGG + Intronic
963286184 3:143436684-143436706 AGGTATAAATGCATTCTGGCTGG + Intronic
965486441 3:169284252-169284274 AGGTAATTATACATGCCAGATGG - Intronic
967210348 3:187162767-187162789 AGCTAAATATGCATTCGGAATGG - Intronic
969064569 4:4468273-4468295 AGGTAAATGTGCATGGTGTAAGG - Intronic
970083996 4:12324602-12324624 AGGAAAATATGAATCCTTGAAGG + Intergenic
970111242 4:12640184-12640206 AGGTAAACATGAGCGCTGGAGGG - Intergenic
970510347 4:16776045-16776067 ATCTAAATATGGATGCTGGCAGG - Intronic
970907204 4:21229961-21229983 AGGTAGATATGAATGTTGGGTGG - Intronic
972852813 4:43071490-43071512 AGATAAATGTGCATGATGTAAGG + Intergenic
973727289 4:53789262-53789284 AGGTAAAAAGGCATGCAGGTAGG - Intronic
976027222 4:80703743-80703765 AGGAAAATATTTATGTTGGATGG - Intronic
978087944 4:104677586-104677608 AGGTATACACGCATGGTGGACGG - Intergenic
979411997 4:120391133-120391155 AGATAAATCTGTATGTTGGATGG + Intergenic
980762328 4:137252124-137252146 AGGTTAATAGGCTTGCTGGAAGG + Intergenic
981279567 4:142942217-142942239 AGGTAAATATGCATAATAAATGG - Intergenic
982199217 4:152943554-152943576 AGGTAAGAATGCAAGGTGGAGGG + Exonic
984209396 4:176826876-176826898 AGGTATGTATGCATGCTGCATGG - Intergenic
986754597 5:10823884-10823906 ATGTACACATGCATGCTGGAGGG + Intergenic
990531662 5:56679968-56679990 GGGTCAGTTTGCATGCTGGATGG - Intergenic
991311463 5:65247692-65247714 AGGAAGATATGCAGGCTGGAAGG + Intronic
996758338 5:126959534-126959556 AAGTAAATATGAATGATGTATGG + Intronic
997500227 5:134368088-134368110 ATTTAAATATGCATGCTGGGTGG - Intronic
997973978 5:138427933-138427955 AGGAAAATATGCAAGGTGAAGGG - Intronic
1001539208 5:172525439-172525461 ATGTAAATATGCAGATTGGAGGG - Intergenic
1004040034 6:11966377-11966399 AGGTACATATGGAGGATGGAGGG - Intergenic
1004916381 6:20336235-20336257 AGGTTAATAAGCAAGCTAGACGG - Intergenic
1007500309 6:42291999-42292021 AGTTAGATAGGCCTGCTGGAGGG - Intronic
1008122439 6:47633839-47633861 AGGTGATTATGCATGAAGGATGG - Intergenic
1008437717 6:51495833-51495855 AGGTGAATTTCCAAGCTGGAAGG + Intergenic
1008616029 6:53227057-53227079 AGGAAAATATGCAAAATGGAGGG + Intergenic
1011128116 6:84028775-84028797 AGCTAAATCAGCCTGCTGGAAGG - Intergenic
1011157377 6:84348110-84348132 AGGAAAATTTGAATGCTTGAAGG - Intergenic
1011836594 6:91438682-91438704 AGGTAAATATGTATGTGTGATGG + Intergenic
1012351253 6:98253622-98253644 TGGTATATATACATGATGGAAGG - Intergenic
1012745452 6:103081398-103081420 AGATAAAGATACATCCTGGAGGG - Intergenic
1013209360 6:107972998-107973020 AGATAAATGTGCATGGTGTAAGG + Intergenic
1015725519 6:136295641-136295663 AGGTAAACTTGCATCCTGGGGGG + Intergenic
1016004613 6:139076880-139076902 AGGTGAATATGCATTTTGGGGGG - Intergenic
1016942833 6:149497583-149497605 AGGTAAATATGCATCCTCTCTGG + Intergenic
1018006366 6:159626116-159626138 AAGAAAATATGCAGGCTGGCCGG + Intergenic
1018273958 6:162110177-162110199 AGGTAGATATGAATACTGAAAGG + Intronic
1019054851 6:169215621-169215643 AGGTTAAAATGCAGGCTGAAGGG - Intergenic
1021512567 7:21450402-21450424 AGGTAAATATACATGCTTTGGGG + Intronic
1023334816 7:39157888-39157910 CAGTAAAAATGAATGCTGGATGG + Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024381267 7:48698873-48698895 TGGTAAATAAGCATGCTACAAGG + Intergenic
1033007220 7:137579628-137579650 AGGTAAATATTCATGCAGGTGGG - Intronic
1039333010 8:36559754-36559776 AAATAAAGATGCATGTTGGATGG + Intergenic
1043716358 8:83491978-83492000 AGGAAATTATGCAGGCTGGGTGG + Intergenic
1043803706 8:84644060-84644082 AGATAAATGTGCATGGTGTAAGG + Intronic
1044187324 8:89269978-89270000 AGGTAAAGATGAATGAGGGAAGG + Intergenic
1045786518 8:105927509-105927531 AGACAATTATGCAAGCTGGAAGG + Intergenic
1047965652 8:130044520-130044542 AGGTGAAACTGAATGCTGGACGG - Intergenic
1048988263 8:139747014-139747036 TGGAAAATATGCCTGCTGGCTGG + Intronic
1049400102 8:142422105-142422127 AGGAAAATTTTCATGCTGAAAGG + Intergenic
1052279691 9:26718887-26718909 AGGTAAATATGAATGTTGGGGGG - Intergenic
1052571325 9:30227878-30227900 AGGTACATCTGCATGATGGCTGG - Intergenic
1054825856 9:69572762-69572784 TGGTAAATAAGCATTCAGGATGG - Intronic
1055453996 9:76456325-76456347 AGGTAAATATTGAGGCTGGATGG - Intronic
1055655147 9:78443634-78443656 AGGTGACTGTGTATGCTGGATGG + Intergenic
1056064433 9:82918892-82918914 AGGTAAATAAAAATTCTGGATGG + Intergenic
1058344313 9:103941975-103941997 AGGTAAGTATTCATGCTGTTTGG - Intergenic
1185558261 X:1038288-1038310 AGATAATCAGGCATGCTGGATGG + Intergenic
1185744351 X:2560048-2560070 ATGTATATATGGATGATGGATGG + Intergenic
1185925610 X:4142509-4142531 AAATAAATATGCATGGTGTAAGG - Intergenic
1186182513 X:6986737-6986759 AGGGAAACTTGCATCCTGGAGGG + Intergenic
1189876875 X:45445530-45445552 AAGTCAATATGAATGCTGGGTGG + Intergenic
1189888277 X:45572286-45572308 AAGTATATATGCATTCTGGAAGG + Intergenic
1195388386 X:104335136-104335158 AGGTAATGATGCAGGCTGGGAGG + Intergenic
1195484714 X:105390828-105390850 TGGTAAATATGCATTCCAGATGG + Intronic
1195977605 X:110544410-110544432 AGGTAAATAAGCATTTTGGCTGG - Intergenic
1196043791 X:111234435-111234457 AGGTCAATCTCCATCCTGGAAGG + Intergenic
1196529001 X:116761434-116761456 AGGTAAACTTGCATCATGGAAGG - Intergenic
1197416686 X:126183910-126183932 AGGTTAATATGCATACTGCAAGG + Intergenic
1199280225 X:145992436-145992458 AGGGAAACATACATGATGGAGGG - Intergenic