ID: 1107202052

View in Genome Browser
Species Human (GRCh38)
Location 13:37733265-37733287
Sequence GGCTCGCTGTGTTTTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107202052_1107202059 29 Left 1107202052 13:37733265-37733287 CCAGTCCCAAAACACAGCGAGCC 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1107202059 13:37733317-37733339 ATGGGTCATGCAGGTAGCCAAGG 0: 1
1: 0
2: 1
3: 33
4: 478
1107202052_1107202058 20 Left 1107202052 13:37733265-37733287 CCAGTCCCAAAACACAGCGAGCC 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1107202058 13:37733308-37733330 TTGCATTCTATGGGTCATGCAGG 0: 1
1: 0
2: 0
3: 9
4: 143
1107202052_1107202057 11 Left 1107202052 13:37733265-37733287 CCAGTCCCAAAACACAGCGAGCC 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1107202057 13:37733299-37733321 TCACTTCTGTTGCATTCTATGGG 0: 1
1: 13
2: 75
3: 254
4: 695
1107202052_1107202056 10 Left 1107202052 13:37733265-37733287 CCAGTCCCAAAACACAGCGAGCC 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1107202056 13:37733298-37733320 GTCACTTCTGTTGCATTCTATGG 0: 1
1: 0
2: 6
3: 30
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107202052 Original CRISPR GGCTCGCTGTGTTTTGGGAC TGG (reversed) Intronic