ID: 1107202052

View in Genome Browser
Species Human (GRCh38)
Location 13:37733265-37733287
Sequence GGCTCGCTGTGTTTTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107202052_1107202058 20 Left 1107202052 13:37733265-37733287 CCAGTCCCAAAACACAGCGAGCC 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1107202058 13:37733308-37733330 TTGCATTCTATGGGTCATGCAGG 0: 1
1: 0
2: 0
3: 9
4: 143
1107202052_1107202059 29 Left 1107202052 13:37733265-37733287 CCAGTCCCAAAACACAGCGAGCC 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1107202059 13:37733317-37733339 ATGGGTCATGCAGGTAGCCAAGG 0: 1
1: 0
2: 1
3: 33
4: 478
1107202052_1107202057 11 Left 1107202052 13:37733265-37733287 CCAGTCCCAAAACACAGCGAGCC 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1107202057 13:37733299-37733321 TCACTTCTGTTGCATTCTATGGG 0: 1
1: 13
2: 75
3: 254
4: 695
1107202052_1107202056 10 Left 1107202052 13:37733265-37733287 CCAGTCCCAAAACACAGCGAGCC 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1107202056 13:37733298-37733320 GTCACTTCTGTTGCATTCTATGG 0: 1
1: 0
2: 6
3: 30
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107202052 Original CRISPR GGCTCGCTGTGTTTTGGGAC TGG (reversed) Intronic
901186545 1:7377093-7377115 TGCTCCCTATGTGTTGGGACTGG - Intronic
901670363 1:10852434-10852456 GGCTTGCTGTGTTTTAAGAGAGG + Intergenic
905037462 1:34927491-34927513 GGCCCGCTGAGTTTTGTGCCAGG - Intronic
907316242 1:53574570-53574592 GGCTTGCTGTGCTGTGTGACCGG - Intronic
916107455 1:161441890-161441912 CGCTCGCTGTGTGTGGGGCCAGG - Intergenic
916109040 1:161449308-161449330 CGCTCGCTGTGTGTGGGGCCAGG - Intergenic
916110627 1:161456689-161456711 CGCTCGCTGTGTGTGGGGCCAGG - Intergenic
916112213 1:161464099-161464121 CGCTCGCTGTGTGTGGGGCCAGG - Intergenic
916113800 1:161471480-161471502 CGCTCGCTGTGTGTGGGGCCAGG - Intergenic
919859772 1:201731871-201731893 GGCTCGCTGTGGCTTGGAAAGGG - Intronic
922859658 1:228805321-228805343 GGCTCTCTGAGTTCTGGGAATGG - Intergenic
923499311 1:234551195-234551217 GCATCGCTGTGCATTGGGACAGG - Intergenic
1062796683 10:350091-350113 GATTCGCTGTTTTTTGAGACAGG + Intronic
1076354724 10:129843294-129843316 GGGTCGCTGTGGGTGGGGACTGG - Intronic
1078137279 11:8661937-8661959 GGCAGGCTGTGTTTTGGGGGAGG - Intronic
1078145495 11:8719418-8719440 GGGTCACTGGGATTTGGGACTGG + Intronic
1081617609 11:44599981-44600003 GGCTTGCTGCGATGTGGGACCGG + Intronic
1084236843 11:67793319-67793341 GGATGGCAGTGTTTGGGGACAGG + Intergenic
1084578388 11:70006103-70006125 GGGTAGGTGTGTTTAGGGACCGG - Intergenic
1084835555 11:71799515-71799537 GGATGGCGGTGTTTGGGGACAGG - Intronic
1087689145 11:101298824-101298846 GGCTATCTATGTTTTGTGACTGG + Intergenic
1090807151 11:130209777-130209799 GGCTCCCTCTGTTTCGGGACTGG + Exonic
1091628363 12:2139840-2139862 GGCCCGCTGTGTCCTGGGAGCGG - Intronic
1091976689 12:4831189-4831211 GGCTCCCTCTGTTTTGAGAAAGG - Intronic
1092098599 12:5864352-5864374 GCCTCCCTGAGTTTTGGGAGAGG - Intronic
1092407730 12:8232631-8232653 GGATGGCGGTGTTTGGGGACAGG + Intergenic
1096329131 12:50693929-50693951 GGCTGGGTCTGTTTGGGGACAGG + Intronic
1099157688 12:79199821-79199843 AGCTCCCTGAGTTTTGGGATAGG - Intronic
1099194526 12:79599713-79599735 AGCTTGATGTGTTTAGGGACAGG - Intronic
1101353747 12:103957201-103957223 GGGTCCCTGTATTTTGGGTCCGG - Exonic
1103867493 12:124064486-124064508 GGTAAGCTGTGTTTTGGGAAAGG + Intronic
1104445938 12:128833586-128833608 TGCTCGCTGTGATTTAGGTCTGG + Intergenic
1106183223 13:27385866-27385888 GGTTCACTGGGTCTTGGGACAGG - Intergenic
1107044591 13:35981398-35981420 GGCTGTCTGTGTGTGGGGACAGG - Intronic
1107202052 13:37733265-37733287 GGCTCGCTGTGTTTTGGGACTGG - Intronic
1108066127 13:46579056-46579078 GGCTCGCTGTGTGCAGGGAAAGG + Intronic
1116119151 14:40699808-40699830 GGCTAGGTTTGTTTTGGGAGAGG - Intergenic
1124441395 15:29688629-29688651 GGCTGCCTGTTTGTTGGGACGGG + Intergenic
1124928730 15:34098184-34098206 GACTGGCTGTGTTAAGGGACTGG + Intronic
1129515501 15:76154681-76154703 AGCTCCCTGAGTTTGGGGACTGG + Intronic
1130353185 15:83108610-83108632 GGGTCGCCGGGTGTTGGGACAGG + Intronic
1131091865 15:89629573-89629595 GCCTGGCTGGGTCTTGGGACAGG - Exonic
1133348443 16:5085758-5085780 GGATGGCGGTGTTTGGGGACAGG + Intronic
1141553680 16:84822759-84822781 AGCACGCTGAGTTCTGGGACAGG + Intronic
1142320190 16:89377165-89377187 GATACGCTGTGTTTGGGGACAGG - Intronic
1142337060 16:89496253-89496275 GGCTCACTGTGTTGTGAGGCTGG + Intronic
1147564525 17:41528165-41528187 GGCTCCGTGCGTTTTGGGCCGGG - Exonic
1152247932 17:79195510-79195532 GGGTGTCTGTGTTTTGGGATGGG - Intronic
1161800129 19:6412789-6412811 TGCTCGCTGGGTGATGGGACCGG - Intergenic
1163466834 19:17472823-17472845 GGCTCCCTTTTTTTTGAGACAGG + Intronic
1164229625 19:23275970-23275992 GGCTTCCTGTGTTCTGGGATGGG + Intergenic
1164245108 19:23421715-23421737 GGCTTCCTGTGTTCTGGGATGGG + Intergenic
1164308951 19:24029810-24029832 GGCTTCCTGTGTTCTGGGATAGG - Intergenic
1165370884 19:35405264-35405286 GGCTCCATGTGTTTTGTGACAGG + Intergenic
1168694882 19:58398413-58398435 GGAGTGCTGTGTTTTGGGAATGG + Intergenic
929076529 2:38083379-38083401 GGCTTGCTTGGTTTTAGGACAGG + Intronic
932598911 2:73111162-73111184 GGCTCTCTGTGGTCTGGGATGGG - Intronic
937097064 2:119242327-119242349 GTCTCCCTGTGGTTGGGGACAGG + Intronic
938260931 2:129894960-129894982 GGTTGGCTGTGTTTGGGGTCAGG - Intergenic
948464560 2:238145960-238145982 GGCTCGCTGTCTGGTGGGGCGGG + Intronic
1174689851 20:52493114-52493136 TGCTCTGTGTGTTTGGGGACGGG + Intergenic
1180980758 22:19877005-19877027 GGCTGGCTCTGTTTGAGGACAGG - Intronic
954199172 3:49014050-49014072 GGCTAGATGAGTATTGGGACCGG + Exonic
957052800 3:75423085-75423107 GGATGGCGGTGTTTGGGGACAGG + Intergenic
961302055 3:125928447-125928469 GGATGGCAGTGTTTGGGGACAGG - Intergenic
961886423 3:130099382-130099404 GGATGGCGGTGTTTGGGGACAGG + Intronic
964105490 3:153035068-153035090 GGCTTGCTGTGTTTTGTGTCCGG - Intergenic
964523345 3:157590653-157590675 GGCTAGCTGTAGTTTGTGACTGG - Intronic
967292610 3:187936000-187936022 GACTCTCTGTGTTTTGAGGCAGG + Intergenic
968995589 4:3943398-3943420 GGATGGCGGTGTTTGGGGACAGG + Intergenic
969758390 4:9165309-9165331 GGATGGCGGTGTTTGGGGACAGG - Intergenic
969818364 4:9702850-9702872 GGATGGCGGTGTTTGGGGACAGG - Intergenic
980449989 4:132958619-132958641 GGCTCTCTGTGTGGTGGGACAGG - Intergenic
982995732 4:162342228-162342250 GGCTCACTGTGAATTGTGACTGG + Intergenic
984826225 4:183927209-183927231 GGCTGGCTGAGTTTGGGCACAGG + Intronic
985607101 5:863663-863685 GGCGCTCTGTGTCTTGTGACTGG + Intronic
986734457 5:10658449-10658471 CACTCACTGTGTTTTGGGAAGGG + Intergenic
988372920 5:30395711-30395733 GCCTCAATGTCTTTTGGGACGGG + Intergenic
1002772898 6:304415-304437 GACTCGCTGGGTTTAGGGCCCGG - Intronic
1007154237 6:39726093-39726115 GGCTAGCTCTGTTTTGGAAAAGG + Intergenic
1008490214 6:52078529-52078551 GTGTCTCTTTGTTTTGGGACTGG - Intronic
1011017702 6:82776242-82776264 GACTCACTTTGTTTTGGAACTGG - Intergenic
1011547695 6:88499264-88499286 GGTTTGCTGTGTTTGGGGAATGG + Intergenic
1018023724 6:159788520-159788542 GGCTCGCTTTGTTTAGGGACAGG - Intronic
1019878618 7:3838656-3838678 AGATCGCTGTGTTCAGGGACGGG - Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1024262240 7:47581645-47581667 GACTGGCTGGGTTTGGGGACTGG - Intronic
1034406956 7:150910869-150910891 GGCTCGCCTTGTTTTTGGACTGG + Intergenic
1036848140 8:12183730-12183752 GGATGGCGGTGTTTGGGGACAGG + Intronic
1036869502 8:12426013-12426035 GGATGGCGGTGTTTGGGGACAGG + Intronic
1037436892 8:18872315-18872337 GACTCTCTGTGTTTTACGACTGG + Exonic
1044361982 8:91296429-91296451 GGGTGGCTGTGTTTTGGGTTGGG + Intronic
1046521389 8:115330761-115330783 GGCTGGCAGTGTTGGGGGACTGG + Intergenic
1049605663 8:143528124-143528146 GGCTTGCTGTGTCTTGGCAGTGG - Intronic
1051245542 9:15107218-15107240 GGCTCCCAGTGTTTGGGGATTGG + Intergenic
1055803443 9:80066640-80066662 GTCTGGATGTGTTTTGGGATGGG - Intergenic
1057290315 9:93802132-93802154 GGTTTGCTGTGTGGTGGGACGGG + Intergenic
1057378133 9:94542908-94542930 GGCTCGTCGGGTTTTAGGACAGG - Intergenic
1059411133 9:114132985-114133007 GCCTCACTGGCTTTTGGGACTGG - Intergenic
1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG + Intronic
1190183229 X:48212034-48212056 AGCTCTCTGTGTTTTGGATCAGG - Intronic
1199461850 X:148093868-148093890 GGCTGGCTTTCTTGTGGGACTGG - Intergenic
1200975400 Y:9207321-9207343 GCCTGGCTGTGTTTTGTGGCTGG - Intergenic
1202135750 Y:21659207-21659229 GCCTGGCTGTGTTTTGTGGCTGG + Intergenic