ID: 1107203490

View in Genome Browser
Species Human (GRCh38)
Location 13:37751823-37751845
Sequence TCACTTTGCTTGGGAGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107203490_1107203493 13 Left 1107203490 13:37751823-37751845 CCTGTATCTCCCAAGCAAAGTGA 0: 1
1: 0
2: 0
3: 15
4: 146
Right 1107203493 13:37751859-37751881 TTACTTCAAATCCAACATCATGG 0: 1
1: 0
2: 1
3: 12
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107203490 Original CRISPR TCACTTTGCTTGGGAGATAC AGG (reversed) Intronic
902427983 1:16339867-16339889 TCACTTAGCCTGGGAAATCCAGG + Intronic
903269034 1:22176455-22176477 TCACTTTGCTCGGGAGGTGCAGG - Intergenic
904069432 1:27782047-27782069 TCACTTTGCTTGGAAGTAGCGGG + Intronic
904183274 1:28682269-28682291 TAACTCTGCAAGGGAGATACTGG + Intronic
904413372 1:30339188-30339210 TCACTTTGCTTCAGAAACACTGG - Intergenic
907333584 1:53686649-53686671 TGACTCTGCTTGAAAGATACAGG + Intronic
910071238 1:83216215-83216237 TCACTTAGCCTGGGAGATTCAGG + Intergenic
910078236 1:83306394-83306416 TAACATTGGTTGAGAGATACTGG - Intergenic
912213613 1:107582354-107582376 TCATTTTGTTTGGGAGAGATTGG - Intronic
912719153 1:112005098-112005120 CCACTTTGCTTGGATGATAAGGG + Intergenic
917551921 1:176041597-176041619 GCACTTTGTTTGGGAGATTGAGG - Intronic
921312599 1:213859034-213859056 TCTCATTGCTTGGGACATGCAGG - Intergenic
923791341 1:237113713-237113735 TCCCTTTGCTTGGAAAATTCTGG - Intronic
1064362603 10:14679516-14679538 TCACTGTGATTGTGAGATAGCGG + Intronic
1064599694 10:16981063-16981085 TCACTTTGAGTGGCAGATCCAGG - Intronic
1066082971 10:31950253-31950275 TCCCTCTTCTTGGGAGATGCAGG + Intergenic
1066524591 10:36262855-36262877 TAACTTTGCTTGGGGCATCCTGG + Intergenic
1069324393 10:67214927-67214949 ACACCTTGCTTGGGATTTACTGG + Intronic
1071814297 10:89216357-89216379 TCATTTTACTTGGGAAATAAAGG + Intronic
1072172274 10:92876771-92876793 TCATTTTCCTTAGGAGATAGGGG + Intronic
1072252266 10:93591032-93591054 ACTCTTTTCTTGGGAGATAAGGG - Intronic
1073195554 10:101687946-101687968 TCTCTTTGCTGAGGAGAAACTGG + Intronic
1073664455 10:105514491-105514513 TCAGATTGCTTGTGAGATAGAGG + Intergenic
1074241858 10:111647581-111647603 TCACATTGTTAGGGAGATGCTGG - Intergenic
1074919373 10:117991925-117991947 TCACTTTGATTTGGGGATTCGGG + Intergenic
1077120037 11:902976-902998 ACACTTTGCTGGGGATGTACTGG - Exonic
1079180079 11:18184927-18184949 TCAATTTCCTTAGTAGATACAGG + Intronic
1079305941 11:19322077-19322099 TCCCTTTGCTTGTAAGATTCTGG + Intergenic
1079809231 11:24974805-24974827 TCAATATGCTTTGGATATACTGG - Intronic
1080285736 11:30608862-30608884 CCACTTTGCTGGAGAGATAAAGG - Intergenic
1080988748 11:37504763-37504785 TCACAGTGTTTGGGACATACTGG + Intergenic
1088059435 11:105628611-105628633 TCACATGGCTGGGGAGACACAGG - Intronic
1088252235 11:107871079-107871101 TCAATTTGATAGGGAGAGACTGG - Intronic
1091455772 12:606750-606772 TCACTTTCTTAGGGAGTTACTGG + Intronic
1093981649 12:25481381-25481403 TCTCTGTGCTAGGGAGATCCTGG - Intronic
1095673959 12:44894347-44894369 TCAATTTGCTTAGGTGAGACAGG - Intronic
1095966893 12:47873946-47873968 TCCCTGTGCTTGGGTTATACAGG - Intronic
1098680833 12:73351797-73351819 TTACTTTTCTTGGGAGATGCAGG - Intergenic
1101435608 12:104661488-104661510 TCACTTAGCTTGGGAGGTTGAGG + Intronic
1101480943 12:105096679-105096701 TCACTTAACCTGGGAGATAGAGG - Intergenic
1102811332 12:115826798-115826820 TCACTCTGCTTTGGCCATACGGG + Intergenic
1102980163 12:117235000-117235022 TCATTGAGCTTGGGAGATAGAGG - Intronic
1106667668 13:31869689-31869711 CCACTGTACTTGTGAGATACTGG - Intergenic
1107203490 13:37751823-37751845 TCACTTTGCTTGGGAGATACAGG - Intronic
1112872990 13:103997587-103997609 TCACATTGCTTTGGGGATATTGG + Intergenic
1113629033 13:111868099-111868121 TCACTTTTCTTTTGAGATTCGGG + Intergenic
1113739726 13:112702850-112702872 TCACTTTGCTGGTGAGACGCTGG - Intronic
1114197410 14:20491104-20491126 TCACTTGGGATGGCAGATACTGG - Intergenic
1114255066 14:20994599-20994621 CCACTTGCCTTGGGTGATACAGG - Exonic
1116162144 14:41281490-41281512 TCACATAGCATAGGAGATACTGG + Intergenic
1118360160 14:65049234-65049256 CCACTTGGCTTGGTAGTTACTGG + Intronic
1118467751 14:66046127-66046149 TTTCTTTACTTGGGAGGTACAGG - Intergenic
1124995034 15:34715412-34715434 TCACTTTGATTAGGAGACATGGG - Intergenic
1126135196 15:45383067-45383089 GCACTGTGCTAGGGATATACTGG - Intronic
1127491848 15:59472433-59472455 CCACTTTGCCTGCGGGATACTGG + Intronic
1130092547 15:80833206-80833228 TCACTTCTCTTGGGAAATTCGGG + Intronic
1132146991 15:99435031-99435053 CCACTTTGCTTGGGAGAAGGGGG - Intergenic
1135388033 16:22061769-22061791 TCTCTTTGCTTAGGAGATCATGG + Intronic
1136655946 16:31709342-31709364 ACACTGTGAATGGGAGATACTGG + Intergenic
1140800470 16:78483283-78483305 TCACTTTACTTGGAAGAGACGGG + Intronic
1141280519 16:82626857-82626879 TCGTTTTGCATGGCAGATACGGG - Intronic
1143469260 17:7161553-7161575 TAACTGTGCTTGGGGGATAAAGG - Intergenic
1144693286 17:17283228-17283250 TGACCTGGCTTGGGAGAAACAGG + Intergenic
1148788885 17:50161928-50161950 TCACTGGGATGGGGAGATACAGG + Intergenic
1149106585 17:52974807-52974829 TCACAATCCTTGGGAGATACTGG + Intergenic
1150454542 17:65296325-65296347 TCACTTGACTTGGGAGATGGAGG - Intergenic
1155823308 18:30406076-30406098 TCATTTTCCTTGGGAGAAATAGG - Intergenic
1157321906 18:46641164-46641186 TCTCTTTGCTGGGGAAATAAGGG - Intronic
1158430904 18:57386382-57386404 TCACTTTGCAAGAAAGATACAGG + Intergenic
1158607754 18:58911083-58911105 TCAGAGTGCTGGGGAGATACTGG + Intronic
1158617971 18:59005360-59005382 TAACTTTGCTGGGCAGATCCTGG + Intergenic
1163384098 19:16988680-16988702 TCCCCTTGCTGGGGAGATAAGGG + Intronic
1164951996 19:32345102-32345124 TCTCTTTGCTTGAGAGATTCAGG - Intergenic
1166324570 19:42041432-42041454 ACACATCGCTTGGCAGATACTGG - Intronic
925753862 2:7114937-7114959 TCATGTTGCTTGGGATAGACAGG + Intergenic
925876089 2:8312348-8312370 TGACTTCCCCTGGGAGATACTGG + Intergenic
931581632 2:63781714-63781736 TCACTTTGCTTGGGGGAACTAGG + Intronic
933332764 2:80915375-80915397 TGACTTTGGGTGAGAGATACGGG + Intergenic
937244498 2:120483810-120483832 TCCCTCTCCTTGGGAGACACTGG + Intergenic
942531747 2:176917518-176917540 TCATTTTGCTTGGTATATAGCGG - Intergenic
943929401 2:193830647-193830669 TTACTTTGGCTGGGATATACAGG + Intergenic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
1168790553 20:573165-573187 TCACTTTGCCTGTGAGCTACAGG + Intergenic
1169879679 20:10332874-10332896 TCACTTTCCCCGGGAGATACTGG - Intergenic
1173330720 20:42074202-42074224 TCATCTTCCATGGGAGATACAGG + Exonic
1173470004 20:43316188-43316210 TCAGTTTGCTTTGGTGATAAAGG - Intergenic
1177047144 21:16184556-16184578 TCGCTCTGCTTGGCAGAGACTGG + Intergenic
1177493153 21:21854531-21854553 TAATTTTGCTTGAGAGATAATGG + Intergenic
1179723441 21:43328990-43329012 GCACTTTGCTTGGCAGCTTCAGG + Intergenic
1179892377 21:44342829-44342851 TCTCTTTGCTTGGAAGCTTCAGG + Intergenic
1184336892 22:43859106-43859128 TCACTGTGCCTGGGAGAGACAGG - Intronic
1184462434 22:44646845-44646867 TCACTTTGATTGGTAGAAACTGG - Intergenic
949887957 3:8711472-8711494 TCACTTGGCTTGGGAGGCAGAGG - Intronic
953795969 3:45986294-45986316 TCACATTACTTGGGAGATGCTGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955419147 3:58719676-58719698 CCCCTTTTCTTGGGAGACACAGG - Intronic
960167195 3:114416435-114416457 TCAATTTGCTTGCAACATACAGG + Intronic
961489346 3:127242415-127242437 TCACTCTGCTTGGGTGTTGCTGG - Intergenic
967717450 3:192778466-192778488 TCACTTTGGTGGGTACATACAGG - Intergenic
971669328 4:29535757-29535779 TCATTTTTATTGGGAGATGCAGG - Intergenic
976620484 4:87121937-87121959 TCATTTTGCTTAGGACATGCTGG - Intronic
977964560 4:103129428-103129450 TCTCTTTTTATGGGAGATACTGG - Intronic
981148802 4:141357031-141357053 TCACTTACTTTGGGAGATAGTGG + Intergenic
981776557 4:148374842-148374864 TCAGTCTTTTTGGGAGATACAGG - Intronic
982550506 4:156792523-156792545 ACATTTTGCTTGTGAGATGCTGG - Intronic
985200179 4:187476544-187476566 TGACCTTGCATGGGAGAAACTGG + Intergenic
986233161 5:5885283-5885305 TCACTTTACTTGAGGGATCCAGG - Intergenic
987673958 5:21050459-21050481 TCATTTTAATTGGGAAATACAGG - Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
989824968 5:45842369-45842391 TCTCTCTGCTTGGGTGTTACTGG + Intergenic
990687611 5:58324024-58324046 TCACTTTGTTTCTGAGAGACAGG - Intergenic
995826233 5:116302735-116302757 TCACTTTCCTAGGGAGCTAGAGG - Intronic
996697843 5:126418554-126418576 TCACTTGGCTTTGGAAATATTGG + Intronic
996874473 5:128226050-128226072 TCACCTTGCTAGGGAGCTCCAGG - Intergenic
996905428 5:128594497-128594519 TCACTTTGCTTGGCTAATTCTGG + Intronic
997011902 5:129888293-129888315 TAACTCTGCTTGGGAAATTCTGG - Intergenic
998168502 5:139858210-139858232 TCACTGTGCTTCAGAGATGCTGG + Intronic
1000242892 5:159425039-159425061 ACACTTTTCTTGGAAGATTCCGG + Intergenic
1005718271 6:28574425-28574447 TAAATTTGCTTGGAAGATATGGG - Intronic
1006483243 6:34316036-34316058 TCACTTTGTTTCGTAGAGACAGG + Intronic
1007805245 6:44439346-44439368 TCATTTCTCTTGGGAAATACTGG + Intronic
1008253847 6:49274078-49274100 TCACTGTCCTTTGAAGATACAGG + Intergenic
1009978038 6:70694151-70694173 TGACTTTGCTGTGGTGATACTGG - Intronic
1009982610 6:70743365-70743387 TCTCTTTTCTGGGGAGATTCTGG + Intronic
1011436221 6:87340152-87340174 TCACTTTGCGTGGCATATATTGG + Exonic
1015361828 6:132348747-132348769 TCTCTTTTCTTGGCAGATAAAGG + Intronic
1017557402 6:155586591-155586613 TAATCTTGCTTGGCAGATACTGG - Intergenic
1019363851 7:620802-620824 TAACTGTGCTTGGGAGGTCCCGG - Intronic
1022076451 7:26975697-26975719 TCACTTTGCTTGGTGGAGATAGG - Intronic
1023949106 7:44827436-44827458 TTACTTTGCTGAGAAGATACAGG - Intronic
1024408428 7:49010095-49010117 TCACTTCTAATGGGAGATACAGG + Intergenic
1025687062 7:63726993-63727015 TCTCTTTTCTTGGTAGACACAGG + Intergenic
1026069947 7:67109901-67109923 TCACTGTGGTTGTGAGCTACTGG - Intronic
1027288952 7:76681163-76681185 TCACTTAGCCTGGGAGATTCAGG + Intergenic
1027296013 7:76771573-76771595 TAACATTGGTTGAGAGATACTGG - Intergenic
1027786479 7:82585344-82585366 TCACTTTACTTAGGAGATGGAGG + Intergenic
1029869932 7:103680146-103680168 TGATTTTTCTTGGAAGATACAGG + Intronic
1032137947 7:129298619-129298641 AAACTTTGCTTGGGGGATAATGG + Intronic
1032661415 7:133988051-133988073 TGACTTTCCTTGAGAGATGCTGG + Intronic
1034161961 7:149000615-149000637 TTACTTGGCTTGGGAAATAATGG - Intergenic
1034193848 7:149230826-149230848 TCACTCTGCTAGTGAGATGCTGG + Intergenic
1034210758 7:149359976-149359998 TTATTTTGCTTTGCAGATACTGG + Intergenic
1037481845 8:19313296-19313318 TCACTCTGCTTGGGTGCTGCAGG - Intergenic
1037781484 8:21872235-21872257 TAACTTCTCTTGGGAGATAATGG + Intergenic
1038432982 8:27514756-27514778 TTCCTCTGCTTGGGAGACACTGG + Intronic
1040922074 8:52632232-52632254 TCACTTTGCTTGGGAAAAATAGG - Intronic
1043254924 8:78123132-78123154 TCACTTTGCTTCAGACACACTGG - Intergenic
1044627026 8:94244006-94244028 TCACCTTCCTTGGTAGATGCTGG + Intergenic
1045912547 8:107427123-107427145 TCACTTAGCCTGGGATATAGTGG + Intronic
1048610018 8:136011980-136012002 TCACTTTGATTGACAGATGCTGG + Intergenic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1055826572 9:80333443-80333465 TCAATTTTCTTAGTAGATACAGG - Intergenic
1059909394 9:119025654-119025676 TTACCTTGCTTGTGTGATACTGG - Intergenic
1060197571 9:121633457-121633479 CCACCTTGCTTTGGAGACACAGG - Intronic
1061272862 9:129553483-129553505 TCACCCTGCTTGGGAGAGGCAGG - Intergenic
1187119578 X:16391511-16391533 TCACTTAGCTTTGGATATTCAGG - Intergenic
1188780871 X:34283095-34283117 TCATTTTGCTGAGGAGATTCTGG + Intergenic
1190580032 X:51883370-51883392 CCACTCTGCTTGGGAGAGACTGG - Intronic
1190918316 X:54826397-54826419 TCACGGTGCTTGGGAGTTCCTGG - Intergenic
1191739573 X:64422719-64422741 TCTCTTTATTTGGGAGATCCAGG - Intergenic
1192584527 X:72308715-72308737 TCACTTTGCTTGCCAGATTGTGG + Intergenic
1196306855 X:114113018-114113040 GCACTGTGCTTGGAACATACTGG + Intergenic