ID: 1107204606

View in Genome Browser
Species Human (GRCh38)
Location 13:37768361-37768383
Sequence GAGCCATGTTACCATGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107204606 Original CRISPR GAGCCATGTTACCATGTAGC AGG Intronic
901315011 1:8301144-8301166 GAGTCATTTTATCCTGTAGCTGG + Intergenic
901933057 1:12609301-12609323 GAGCCGTGTCACCCTGAAGCTGG + Intronic
902750992 1:18510875-18510897 GGGCCATGTTACAATGGAGGAGG + Intergenic
907717274 1:56938812-56938834 AAGCCAACTTACCAGGTAGCTGG - Intronic
908839647 1:68266001-68266023 CAGCCATATTACCATCTAGAAGG - Intergenic
910981492 1:92962854-92962876 AAGCCATCCTCCCATGTAGCTGG + Intergenic
911295873 1:96114237-96114259 GACTCAGGTTCCCATGTAGCTGG + Intergenic
922632426 1:227129960-227129982 GAGCCATGGTTACCTGTAGCTGG - Intronic
922853013 1:228750161-228750183 GGGCCAATTTACCATGTGGCTGG - Intergenic
924741453 1:246796468-246796490 GAGCCCTGTCACCAGGTGGCTGG + Intergenic
1062870085 10:893696-893718 GGGACATCTTACCATGAAGCAGG + Intronic
1062912048 10:1217641-1217663 CAGCCAGCTTACCATGGAGCCGG - Intronic
1064160113 10:12938073-12938095 GAGCCAGGTTTCAATGAAGCAGG - Intronic
1070976750 10:80611486-80611508 GAGCCATGTGTCCCTGGAGCTGG + Intronic
1074295883 10:112188753-112188775 GAGCCATGTTAAAATGTAGCAGG - Intronic
1078781464 11:14442896-14442918 GAGCCAGGTTTCCATTAAGCAGG + Intergenic
1081118801 11:39238182-39238204 GAGCCATCCTACCATCCAGCTGG - Intergenic
1088049717 11:105497616-105497638 GAGCCATTTTTCCAAGAAGCTGG + Intergenic
1091532640 12:1374391-1374413 GAGACAAGTTACCCTGTAGGGGG - Intronic
1097705266 12:62861837-62861859 GAGCCATATTCCCAGGCAGCTGG - Intronic
1105408284 13:20149725-20149747 GAGCAATGTTTCCATGAAGGTGG + Intronic
1106316496 13:28599013-28599035 GAGCCATTCTACCTTGTATCAGG + Intergenic
1106499458 13:30313449-30313471 GAAGCATGTTACAATGTAGGTGG + Intergenic
1107204606 13:37768361-37768383 GAGCCATGTTACCATGTAGCAGG + Intronic
1108672257 13:52703625-52703647 GAGTCATCATGCCATGTAGCTGG - Exonic
1108782877 13:53858133-53858155 GAGAAATGTTACCATGAAACAGG + Intergenic
1109735147 13:66473560-66473582 GACTCATGTTACAATGTAACTGG + Intronic
1113251644 13:108459629-108459651 GAGCAGTGTTGCCATGTAACTGG - Intergenic
1113879689 13:113617277-113617299 GAGCAATGTCTCCATGGAGCGGG + Intronic
1113975051 13:114221342-114221364 GAGCCATGTTGGCTTGTTGCTGG - Intergenic
1120249221 14:82042050-82042072 GAGTCTTGTAACCATGTAACAGG + Intergenic
1121823382 14:96990079-96990101 GAGCCATGTGACCAGGGTGCAGG - Intergenic
1123714242 15:23014624-23014646 AAGCCATGTGACCATGTCCCAGG + Intronic
1124205562 15:27716079-27716101 GAGACATGTTACCATGGAGATGG - Intergenic
1127301268 15:57656119-57656141 AATCCAGGTTACCATATAGCTGG - Intronic
1130822030 15:87506089-87506111 GATCCCTGTTTCCCTGTAGCTGG + Intergenic
1136177181 16:28525242-28525264 GGGCCAGGTTATGATGTAGCAGG + Intergenic
1140394493 16:74615110-74615132 GAGCCATGTGACCATGATGCTGG + Intergenic
1144185148 17:12789760-12789782 GAGCCATGTAACCCTGCGGCGGG + Exonic
1155912109 18:31515943-31515965 GATCCATGTGACCATGCAGATGG + Intronic
1157830501 18:50852810-50852832 GAACCAGGTGACCATGTAGGAGG - Intergenic
1164312285 19:24056552-24056574 GACTCATGTCACCATGTTGCTGG - Intronic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1166670508 19:44706949-44706971 GAGCCATGTTTCCCTGTCCCAGG - Intronic
1168607177 19:57769562-57769584 CAGCCACGTTACCATTTCGCAGG - Intergenic
928276165 2:29902132-29902154 GTGCCATGTTTCCAGCTAGCAGG + Intronic
928325825 2:30318702-30318724 GAGCCATGTTCCCATGAAGTGGG + Intronic
946322999 2:218964455-218964477 GAGCCATGTTCCCCTGTCCCTGG + Intergenic
947898448 2:233698092-233698114 GAGCCCTGTGACCCTGTATCTGG + Intronic
1171726337 20:28624500-28624522 GACACTTGTCACCATGTAGCTGG - Intergenic
1171751796 20:29058874-29058896 GACACTTGTCACCATGTAGCTGG + Intergenic
1171790530 20:29518996-29519018 GACACTTGTCACCATGTAGCTGG - Intergenic
1172922368 20:38495902-38495924 GACCTAAGTTACCATGTAGGAGG + Intronic
1173566937 20:44047301-44047323 GAGCAATTTTACCATGCAGGGGG - Intronic
1174759003 20:53187932-53187954 GAGCCATGTTACCAGGAGGCGGG - Intronic
1180391228 22:12284109-12284131 GACACTTGTCACCATGTAGCTGG - Intergenic
1180408512 22:12580644-12580666 GACACTTGTCACCATGTAGCTGG + Intergenic
949599510 3:5582703-5582725 TAGACATGTGAACATGTAGCTGG + Intergenic
949927077 3:9049873-9049895 AAGCCATGCTCCCAAGTAGCTGG + Intronic
950015355 3:9751107-9751129 GAGCCAGGGTAACATCTAGCTGG - Exonic
958188636 3:90155988-90156010 AAGCGATGTTACCATCTAACTGG + Intergenic
960918678 3:122724159-122724181 AAGCCATGTTACCTTTTAGTGGG + Intronic
962241477 3:133754438-133754460 GAGCCATGTTTCCCTGCACCAGG + Intronic
965667039 3:171106128-171106150 GAAGCATGTTTCCATGTATCTGG - Intronic
965978539 3:174657221-174657243 TTGCCATGTTGCCATGTTGCTGG + Intronic
976398421 4:84582609-84582631 GAGCGCTGTTAACATTTAGCGGG + Intergenic
976815012 4:89138073-89138095 GAGCCATCAGACCATGAAGCAGG - Intergenic
983492637 4:168406631-168406653 GAGCCATGGTATCATAAAGCTGG + Exonic
988564458 5:32310199-32310221 AAGCCATTTTCCCAAGTAGCTGG - Intronic
990535492 5:56717478-56717500 GAGCACTGTCACCATGTGGCCGG + Intergenic
992472771 5:77074887-77074909 GCGCAATGTTACCATGGAGCTGG + Exonic
1005942889 6:30574234-30574256 AAGCCATCTTCCCTTGTAGCTGG + Intronic
1007234373 6:40379709-40379731 GAGCCAAGTTTCCATGTTGATGG - Intergenic
1008082294 6:47207249-47207271 GAGCTGTTTAACCATGTAGCTGG + Intergenic
1012489963 6:99771602-99771624 GGGCCCTGTTACAATGTAACTGG - Intergenic
1015065219 6:129017657-129017679 CAGCCATGTCACCATGTGTCTGG - Intronic
1026991756 7:74590033-74590055 CAGCCATGTCACCAGGGAGCAGG - Intronic
1028830148 7:95318707-95318729 GAACCATGTTGCCATTTACCCGG - Intronic
1030188041 7:106782337-106782359 TAGCCATATTACCATGTGCCTGG - Intergenic
1031581906 7:123486501-123486523 TAGCCTTGCTACCAAGTAGCTGG + Intronic
1032259121 7:130320596-130320618 GACCCATATTTCCATGTAACAGG + Intronic
1033395980 7:140974084-140974106 GAGCCATGTTACCAGTTTTCAGG + Intergenic
1034380867 7:150691277-150691299 GAGCCATGGTGCCATTTCGCTGG - Intronic
1038167725 8:25101823-25101845 GTAACATGTTACCATGTAACAGG + Intergenic
1042252703 8:66772961-66772983 CACTCACGTTACCATGTAGCAGG - Intronic
1046012422 8:108565612-108565634 GAGCCTTGTTACCACCTAGTGGG + Intergenic
1047993974 8:130315926-130315948 GAGCCATGAAACCAGGTAGAGGG - Intronic
1053373102 9:37579177-37579199 GGTCTAAGTTACCATGTAGCTGG + Intronic
1053723277 9:40971359-40971381 GACACTTGTCACCATGTAGCTGG + Intergenic
1054342687 9:63880633-63880655 GACACTTGTCACCATGTAGCTGG - Intergenic
1056707250 9:88961682-88961704 GTGGAATGTTACAATGTAGCTGG - Intergenic
1057828284 9:98387979-98388001 GAGCCATGGCACCATGTAGGTGG + Intronic
1059887565 9:118763573-118763595 GAGAAATTTTACCATGTAGAGGG - Intergenic
1061710551 9:132484540-132484562 GATCCATGTTACAATGTGGATGG - Intronic
1203451868 Un_GL000219v1:124619-124641 GACACTTGTCACCATGTAGCTGG - Intergenic
1189822944 X:44887891-44887913 GAGCGGTTTTCCCATGTAGCTGG - Intronic
1191053305 X:56217266-56217288 GAGCCCTTTTACCATATTGCTGG - Intergenic
1198587211 X:138135720-138135742 AAGCCATGGTAGCATGGAGCAGG - Intergenic
1199092166 X:143705256-143705278 GAGCCCTGTCCCCATGGAGCTGG + Intergenic