ID: 1107206222

View in Genome Browser
Species Human (GRCh38)
Location 13:37792143-37792165
Sequence AAACCCTTGATGAAACTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107206222_1107206224 -10 Left 1107206222 13:37792143-37792165 CCAGTGAGTTTCATCAAGGGTTT 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1107206224 13:37792156-37792178 TCAAGGGTTTACAAGGAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107206222 Original CRISPR AAACCCTTGATGAAACTCAC TGG (reversed) Intronic
900946920 1:5836142-5836164 AAAGCCTTGATCAAACTCTTGGG - Intergenic
900946941 1:5836310-5836332 AAAGCCTTGATCAAACTCTTGGG - Intergenic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
905307244 1:37028224-37028246 AAAGCCTTGAGGAAACCCAAGGG - Intronic
905547765 1:38813449-38813471 AAACCCATGATAAAAATCTCTGG + Intergenic
907950247 1:59176353-59176375 ACACCCTTGTTGAAAATCACTGG + Intergenic
910323070 1:85971299-85971321 AAAACCTTGCTGAAGCTGACTGG + Intronic
911594479 1:99784829-99784851 ACACCTTTGATAAACCTCACTGG + Intergenic
915097333 1:153472596-153472618 AAATCCTTAATAAAACTCGCTGG + Intergenic
916369100 1:164069133-164069155 AAAACCTTGATGAAAATAATTGG - Intergenic
920405998 1:205711506-205711528 AAATCTTTGATGTAACTCATTGG + Intergenic
922095686 1:222441058-222441080 GAAACCCTGATGAAAATCACTGG + Intergenic
923258322 1:232241768-232241790 AAAACATTGGTGAAACTCTCTGG + Intergenic
1063433189 10:6008849-6008871 AACCCCTCCATGAAAATCACTGG + Intergenic
1066779661 10:38930688-38930710 AAACCTTAAATGAGACTCACAGG + Intergenic
1066951555 10:42122949-42122971 AAGCCTTAAATGAAACTCACAGG - Intergenic
1069161106 10:65093416-65093438 AATGCCTGGAGGAAACTCACAGG + Intergenic
1074662670 10:115679360-115679382 CAACCCTCTCTGAAACTCACTGG + Intronic
1077478604 11:2802670-2802692 AACCCCTAGATGACACTCACTGG + Intronic
1080271537 11:30455672-30455694 ACACCGTTGATGAAGCGCACAGG - Intronic
1081598864 11:44477965-44477987 AAACCCCTGATAAAACTATCAGG - Intergenic
1088434576 11:109796780-109796802 CAACCCTGGAGGAGACTCACAGG + Intergenic
1093871192 12:24293345-24293367 AAAGCCTTGGTGAAAACCACAGG - Intergenic
1095422221 12:42036960-42036982 AAAACATTGAGGAAACTCTCCGG + Intergenic
1096275523 12:50204296-50204318 AAACTCTCAATGATACTCACTGG + Intronic
1096399533 12:51293999-51294021 AAACTCTTGATAATATTCACAGG + Intronic
1097119934 12:56724058-56724080 AAAACCTTGATGCAACTTGCTGG + Intronic
1099024359 12:77447277-77447299 AAACACTTGATAAGACTCAAAGG - Intergenic
1101314923 12:103620327-103620349 AAACCCTAGATGACACCAACAGG + Intronic
1103137471 12:118519877-118519899 AATCCCTTGAGGAAACTCTGGGG - Intergenic
1104104526 12:125646452-125646474 AAACCCTTGCTGAAACTTGAAGG + Intronic
1105616276 13:22016007-22016029 AAACCCTTTATGACACTCTATGG + Intergenic
1107206222 13:37792143-37792165 AAACCCTTGATGAAACTCACTGG - Intronic
1109093426 13:58078647-58078669 AAACCCTTGAAGAAATTCTTAGG + Intergenic
1109682588 13:65772216-65772238 AAATCCATAATAAAACTCACTGG + Intergenic
1110371249 13:74743116-74743138 AACACCTTGATGGAACTGACTGG - Intergenic
1111211437 13:85084913-85084935 AAACTCTTGTTGAAACTCAGGGG - Intergenic
1111485137 13:88887774-88887796 AATCCCCTGATTAAACTCAACGG + Intergenic
1113385723 13:109846181-109846203 GAACCCTGGATGGAACTCCCTGG + Intergenic
1116413394 14:44651251-44651273 AAAACATTGAGGAAACTCTCTGG + Intergenic
1116965842 14:51014315-51014337 AAACCCCTGCTGAAACTCCCCGG - Intronic
1117126601 14:52634302-52634324 AAACCCTAGATAAAACTCTTGGG + Intronic
1120678651 14:87452731-87452753 AAACCCTTGATAGTACTCTCAGG + Intergenic
1121122948 14:91387674-91387696 AAAGCCTTGTGGAAACTCCCTGG - Intronic
1121292474 14:92787544-92787566 ACACCATAGATGAAACTCATAGG - Intergenic
1123395617 15:19932321-19932343 AAGCCTTAAATGAAACTCACAGG + Intergenic
1126417033 15:48428377-48428399 AAACCCATCATTACACTCACAGG + Exonic
1127098734 15:55541098-55541120 AAACTTTTGATGAAACTCAGTGG - Exonic
1127920573 15:63491228-63491250 AAAGGATTGATGAAACTCTCAGG - Intergenic
1130649709 15:85755563-85755585 AAAGCGTTGAGGAAGCTCACAGG + Intergenic
1131466700 15:92661277-92661299 AAGCCAGTGATGCAACTCACAGG - Intronic
1132900333 16:2250661-2250683 GAACCCTTGGTAAAACCCACTGG - Intronic
1133599872 16:7328694-7328716 AAATCCTTGATGGAAATCTCTGG + Intronic
1135093718 16:19544049-19544071 AAATCCTTAATGAAACTTGCTGG + Intronic
1135962676 16:27010791-27010813 TGCCCCTTGCTGAAACTCACTGG - Intergenic
1136769534 16:32823365-32823387 AAGCCTTAAATGAAACTCACAGG - Intergenic
1136935754 16:34462297-34462319 AAGCCTTAAATGAAACTCACTGG - Intergenic
1136939804 16:34512141-34512163 AAGCCTTAAATGAAACTCACAGG - Intergenic
1136945959 16:34651647-34651669 AAGCCTTAAATGAAACTCACAGG + Intergenic
1136948801 16:34690213-34690235 AAGCCTTAAATGAAACTCACAGG + Intergenic
1136956280 16:34790675-34790697 AAGCCTTAAATGAAACTCACTGG + Intergenic
1136960016 16:34836425-34836447 AAGCCTTAAATGAAACTCACTGG + Intergenic
1136964064 16:34886273-34886295 AAGCCTTAAATGAAACTCACTGG + Intergenic
1136968204 16:34940859-34940881 AAGCCTTAAATGAAACTCACTGG + Intergenic
1137088690 16:36161504-36161526 AAGCCTTAAATGAAACTCACAGG + Intergenic
1137219932 16:46438503-46438525 AAGCCTTAAATGAAACTCACAGG - Intergenic
1138729021 16:59174432-59174454 AAAACCTTGACCATACTCACAGG + Intergenic
1140252218 16:73304265-73304287 AGACCCCTGATGAAGTTCACAGG + Intergenic
1140663002 16:77206172-77206194 ATCCCCTTAATGAAACTCAGGGG - Intronic
1203071951 16_KI270728v1_random:1085470-1085492 AAGCCTTAAATGAAACTCACAGG - Intergenic
1143849425 17:9798797-9798819 AAACACCTGATAAAATTCACTGG + Intronic
1144090503 17:11851770-11851792 AAACCCTAGATGAAGTACACAGG - Intronic
1145692238 17:26754739-26754761 AAGCCTTAAATGAAACTCACAGG + Intergenic
1146517362 17:33499660-33499682 AAACACCTGATGATACTGACTGG + Intronic
1149249156 17:54748277-54748299 AAAACATTGAGGAAACTCTCTGG - Intergenic
1150939057 17:69670426-69670448 AAACCATTGATTAACCTCAAGGG + Intergenic
1151250278 17:72828860-72828882 ACAGATTTGATGAAACTCACAGG + Intronic
1152209202 17:78994159-78994181 AAATCCCTGATGCAGCTCACAGG - Intronic
1203183764 17_KI270729v1_random:92284-92306 AAGCCTTAAATGAAACTCACAGG + Intergenic
1153537781 18:6120768-6120790 ATAACCTGGATGAAGCTCACAGG - Intronic
1153541483 18:6160381-6160403 AAAACCTTGTTTAATCTCACAGG + Intronic
1156482776 18:37446492-37446514 ATACCCTTGATTAAAGTCCCTGG + Intronic
1158098058 18:53797580-53797602 AATGCCTTGAAGAATCTCACTGG - Intergenic
1158233243 18:55282943-55282965 AAAGACTTGGTGAAACTCATAGG + Intronic
1158441741 18:57480810-57480832 AAATCCTTGAGTAAACTCACTGG - Exonic
1159945742 18:74443422-74443444 CAACCCTTTTTGAAACTCCCAGG - Intronic
1161033726 19:2072488-2072510 AAACCCTTTATGATACACAAAGG + Exonic
1202671888 1_KI270709v1_random:62824-62846 AAGCCTTAAATGAAACTCACAGG + Intergenic
925104325 2:1277648-1277670 AAACTCATGTTGAAATTCACAGG - Intronic
926947314 2:18202514-18202536 AAACCCTTGATAAAACCATCAGG - Intronic
931125677 2:59273866-59273888 AAATCCTCTATGAAACTCTCAGG - Intergenic
931959211 2:67463280-67463302 AAAGCCATGATGTAACACACAGG + Intergenic
934249543 2:90337486-90337508 AAGCCTTAAATGAAACTCACAGG - Intergenic
934260035 2:91465966-91465988 AAGCCTTAAATGAAACTCACAGG + Intergenic
935256240 2:101312606-101312628 AAACCCTCGTTGACACTCATAGG - Intergenic
939873517 2:147550765-147550787 AAACCCTTAATGAAAGTAACAGG + Intergenic
941751623 2:169140690-169140712 AAGACCTTAAGGAAACTCACTGG - Intronic
944399632 2:199310531-199310553 AAACCCTTGAGGAAACACTTGGG - Intronic
945218637 2:207462373-207462395 AAACAATAGATGAATCTCACAGG + Intergenic
1168929793 20:1611758-1611780 AAACACTTGAGGAAACACAGAGG - Intronic
1168968552 20:1915032-1915054 AAACACTTGAGGAAACACAGAGG + Intronic
1170543282 20:17410439-17410461 CAACCCTTGATGAGACTGAGGGG - Intronic
1175478960 20:59298307-59298329 AAACCCTGGATGAGCCTCTCAGG - Intergenic
1176585729 21:8583564-8583586 AAGCCTTAAATGAAACTCACAGG + Intergenic
1177288056 21:19076849-19076871 AAACCCCTGATAAAACCGACAGG - Intergenic
1179410739 21:41161059-41161081 AAACCCTAGATGACACTCTCAGG + Intergenic
1180268538 22:10560463-10560485 AAGCCTTAAATGAAACTCACAGG + Intergenic
1185180006 22:49354179-49354201 AAAAGATTGATGAAATTCACTGG - Intergenic
1203323053 22_KI270737v1_random:87180-87202 AAGCCTTAAATGAAACTCACAGG - Intergenic
949881343 3:8663450-8663472 AAAGCCCTGATGAAACTATCAGG - Intronic
955731264 3:61989774-61989796 AAAACCTGGATGAAAAACACAGG + Exonic
956974014 3:74559300-74559322 AAACCACTGATGCAAATCACTGG - Intergenic
958849692 3:99309422-99309444 TCACACTTGATGACACTCACAGG - Intergenic
961727155 3:128938953-128938975 AAAGCCTTGCTGAAACTCACTGG - Intronic
966601491 3:181779555-181779577 AATCCCTTAATGAAACTTTCTGG - Intergenic
970265140 4:14274525-14274547 AAACCACAGAGGAAACTCACAGG + Intergenic
970598512 4:17621788-17621810 AAAGCCTGAATGAAACTCGCAGG - Intronic
971151321 4:24035129-24035151 AAACACTTGTTGAAACTAACAGG + Intergenic
974020185 4:56686503-56686525 AAACCCTGGATGAATCTAAATGG - Intergenic
974419728 4:61657949-61657971 AAATGCTTGATGAAAGACACTGG + Intronic
974656105 4:64824786-64824808 AATGCCGTGATGAAACTCAAAGG - Intergenic
981227757 4:142317062-142317084 AAGCCTTTCCTGAAACTCACAGG - Intronic
981642907 4:146966228-146966250 AAACCCTTGATCAAACCATCAGG - Intergenic
981754210 4:148123525-148123547 AAACCCTTAATAAAACTTGCTGG + Intronic
982933118 4:161434461-161434483 AAAACATTGAGGAAACTCAATGG + Intronic
983635137 4:169890230-169890252 AAACACTTCAAGATACTCACTGG - Intergenic
984470932 4:180172428-180172450 AAAGAGTTAATGAAACTCACTGG + Intergenic
985374424 4:189319485-189319507 AAAACATTGAGGAAACTCTCTGG - Intergenic
986614837 5:9605503-9605525 AAACGCTTCATGAAATGCACTGG - Intergenic
987786737 5:22510043-22510065 ACACCCTCAATGAAACTCAGTGG + Intronic
990331120 5:54726506-54726528 AAAATGTTGATGAAACTCAAGGG + Intergenic
993537401 5:89103754-89103776 AAACTCTTGAAGAAAGTCAGGGG + Intergenic
996977131 5:129448435-129448457 AAGCGCGTGCTGAAACTCACGGG - Intergenic
999539500 5:152556249-152556271 AAACCCTTGAGAGAACTCAAAGG - Intergenic
1000536627 5:162486040-162486062 AAACCCTTGACCAAAGGCACTGG - Intergenic
1002320560 5:178373116-178373138 AAACCCTTGGTAAAAAGCACAGG + Intronic
1003972911 6:11316211-11316233 AAAGCCTTCAGGAAACTCAAAGG - Intronic
1004364726 6:15002338-15002360 AAACCCTTGACCAAACTCCCTGG + Intergenic
1006709500 6:36054744-36054766 AAACCCTCAATTAAACTTACCGG - Intronic
1008717203 6:54303320-54303342 AACCCCTTGTTGAAACCCACTGG + Intergenic
1010925211 6:81736407-81736429 AAACACTTTGTGAAAATCACAGG + Intronic
1015558664 6:134490618-134490640 AAACATTTAATGAAAATCACCGG - Intergenic
1015703846 6:136066015-136066037 AAAGCCTTTATGGAAATCACTGG - Intronic
1016556141 6:145340859-145340881 AGACCCTGGAAGAGACTCACAGG + Intergenic
1019044860 6:169137541-169137563 AAAACATTGAGGAAGCTCACTGG + Intergenic
1020711615 7:11613250-11613272 AAACATTTGATGGAACTCTCTGG + Intronic
1021775691 7:24053132-24053154 AAACCCTTGAGGCAGCTGACTGG - Intergenic
1023095535 7:36656230-36656252 CAACACGGGATGAAACTCACAGG + Intronic
1024201629 7:47114478-47114500 AAACACTTTATGAAAGGCACTGG - Intergenic
1025321506 7:58099362-58099384 AAGCCTTAAATGAAACTCACAGG + Intergenic
1025474648 7:60904618-60904640 AAGCCTTAAATGAAACTCACAGG + Intergenic
1025488240 7:61078355-61078377 AAGCCTTAAATGAAACTCACAGG - Intergenic
1025512355 7:61585256-61585278 AAGCCTTAAATGAAACTCACAGG - Intergenic
1025551290 7:62252855-62252877 AAGCCTTAAATGAAACTCACAGG - Intergenic
1025556912 7:62320311-62320333 AAGCCTTAAATGAAACTCACAGG - Intergenic
1027470981 7:78573854-78573876 AAACCCTTCATGAAAGAAACTGG - Intronic
1027704192 7:81509358-81509380 AAACCCTTGATAAACCCAACAGG - Intergenic
1030995836 7:116357459-116357481 GAGCCCTTCAAGAAACTCACTGG - Intronic
1036017913 8:4806687-4806709 ATACTCTACATGAAACTCACAGG - Intronic
1038002945 8:23405793-23405815 AATCCCTTGATTAAGCTGACAGG + Intronic
1038344826 8:26722841-26722863 AAAACCTGGATGAACCTCAAGGG + Intergenic
1043179581 8:77070239-77070261 TATCCCTTGATAAAACTCAGTGG + Intergenic
1046884860 8:119354964-119354986 AAATCCTTGTTGAAAGGCACTGG - Intergenic
1047066113 8:121284948-121284970 AACAACTTGATGAAACTCACTGG + Intergenic
1048098190 8:131317447-131317469 AAACCATTGAAATAACTCACCGG + Intergenic
1055219910 9:73916577-73916599 AAACCACAGATGAAACTTACAGG - Intergenic
1057326682 9:94070806-94070828 ACAACCTGGATGAAACTCAAAGG - Intronic
1062367386 9:136217424-136217446 AAACCCGAGCTGAAGCTCACAGG + Intronic
1203615630 Un_KI270749v1:61084-61106 AAGCCTTAAATGAAACTCACAGG + Intergenic
1185482773 X:460027-460049 ACACGCTTGATAAAACTGACAGG - Intergenic
1188814930 X:34701201-34701223 AAAACATTGGGGAAACTCACTGG + Intergenic
1192592036 X:72368339-72368361 AAAGCCTTGTGGAAACACACGGG - Intronic
1196586875 X:117440139-117440161 AACACTTTGATGAATCTCACTGG - Intergenic
1197004665 X:121481389-121481411 AAACCCTTAATAAAACTTGCTGG - Intergenic