ID: 1107207377

View in Genome Browser
Species Human (GRCh38)
Location 13:37808933-37808955
Sequence GAGTCTTACCACTATGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107207377_1107207381 14 Left 1107207377 13:37808933-37808955 CCTACATCATAGTGGTAAGACTC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1107207381 13:37808970-37808992 TTCAGTTTTTCTTTCAAAAGGGG 0: 1
1: 0
2: 6
3: 75
4: 684
1107207377_1107207380 13 Left 1107207377 13:37808933-37808955 CCTACATCATAGTGGTAAGACTC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1107207380 13:37808969-37808991 ATTCAGTTTTTCTTTCAAAAGGG 0: 1
1: 0
2: 1
3: 73
4: 781
1107207377_1107207379 12 Left 1107207377 13:37808933-37808955 CCTACATCATAGTGGTAAGACTC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1107207379 13:37808968-37808990 CATTCAGTTTTTCTTTCAAAAGG 0: 1
1: 0
2: 3
3: 61
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107207377 Original CRISPR GAGTCTTACCACTATGATGT AGG (reversed) Intronic
908984003 1:69995362-69995384 GATTCTTCACACTAGGATGTAGG - Intronic
913552979 1:119935063-119935085 AAGTCTTACCTCTATAAGGTGGG - Intronic
914520525 1:148411221-148411243 GACTCTTAGGACTATGAGGTGGG + Intergenic
924917919 1:248593019-248593041 GAGGCTGACCACTGTAATGTGGG + Exonic
1066302002 10:34105506-34105528 GAGTCTTCCCACTGTGAAGCTGG - Intergenic
1079412481 11:20201958-20201980 AAGTCTTGCCACTTTGATATTGG + Intergenic
1083806618 11:65078262-65078284 GAGTCTTACCACTCTGCTGCAGG - Exonic
1098009826 12:66039051-66039073 GAGTCTTACAAATGTGATGTGGG - Intergenic
1099329634 12:81267461-81267483 ATGTCTTAGGACTATGATGTGGG + Intronic
1106599033 13:31171709-31171731 AAATCTTACCAGTAAGATGTGGG + Intergenic
1107207377 13:37808933-37808955 GAGTCTTACCACTATGATGTAGG - Intronic
1107887331 13:44884666-44884688 GAGTCCAGCCACTATGCTGTGGG - Intergenic
1115308365 14:31955209-31955231 GAGTCTTGCCTCTATGTTGATGG - Intergenic
1116678720 14:47938976-47938998 GAGCCTTACCAGTTTGATATTGG + Intergenic
1118656396 14:67954581-67954603 TAGTTTTAATACTATGATGTGGG + Intronic
1202840415 14_GL000009v2_random:115941-115963 GAGTCTTACCAGTTTGATACTGG + Intergenic
1124551671 15:30686689-30686711 GAGTCTCATCACTTTGTTGTTGG - Intronic
1124679577 15:31718975-31718997 GAGTCTCATCACTTTGTTGTTGG + Intronic
1126285891 15:47009891-47009913 GATTCTAACCACTGGGATGTAGG + Intergenic
1126536686 15:49774217-49774239 GTTTCTTACCAGTATAATGTTGG + Intergenic
1128414405 15:67431157-67431179 AAGTCTTACAAATATCATGTTGG + Intronic
1131313649 15:91313017-91313039 GAGGCTTAACACTATGGAGTAGG + Intergenic
1134090367 16:11388361-11388383 GAGTCTTTTCCCCATGATGTGGG + Intronic
1135888006 16:26329969-26329991 GAGTTTTACATCTATGACGTGGG - Intergenic
1138305101 16:55967070-55967092 GAGTCTTAAAAGTATGAAGTGGG - Intergenic
1149212951 17:54324913-54324935 GAGTCTTGCCAGTTTGATATTGG - Intergenic
1150044199 17:61895529-61895551 GAGTATTAACACTTTAATGTTGG - Intronic
1155216464 18:23647755-23647777 CAGTTTTCCCACTGTGATGTAGG + Intronic
1163040163 19:14596304-14596326 GAGTCTCATCCTTATGATGTAGG - Intronic
930225859 2:48792252-48792274 GAGTCCTGCCACCATGATCTAGG + Intergenic
941077702 2:161024723-161024745 GGGTCTTACTTCTATGATGGTGG - Intergenic
1169124731 20:3119304-3119326 GAATCTTGCAACAATGATGTGGG + Intronic
1170317075 20:15054407-15054429 GAGTCTTGCCTCTATGGTGATGG - Intronic
1174701944 20:52617732-52617754 GAGTCTTACCACTTCCATTTTGG + Intergenic
1176629145 21:9120846-9120868 GAGTCTTACCAGTTTGATACTGG + Intergenic
1178228344 21:30751273-30751295 GACTCTCACCACTTTGATGCTGG + Intergenic
949451051 3:4185388-4185410 GAATCTAACAACTAAGATGTTGG + Intronic
951325170 3:21293513-21293535 TAGTCTTACCACCATGTTATAGG - Intergenic
953364325 3:42329436-42329458 GAATGTTTCCACTTTGATGTTGG - Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
957095477 3:75773516-75773538 GAGTCTTACCAGTTTGATACTGG + Intronic
961176160 3:124836678-124836700 GAGTCCTACCAATATACTGTAGG + Intronic
963039431 3:141057910-141057932 GAGTCTGACCCCTTTGGTGTAGG + Intronic
966670661 3:182522621-182522643 GAGTCTTTCCCCTTTCATGTTGG - Intergenic
967187489 3:186957494-186957516 GAGTCTTACTATTCTGATGTTGG - Intronic
975374316 4:73625802-73625824 GAGGTTTACCAACATGATGTTGG + Intergenic
975570714 4:75815145-75815167 GATTCTTACCCCTAAGGTGTTGG + Intergenic
977912847 4:102557860-102557882 GAATCTAACCACTAAGAGGTAGG - Intronic
978119960 4:105066710-105066732 GAGGCTGTCCACTATGATATGGG - Intergenic
979470651 4:121092189-121092211 GAGGTTTACCACTATGTGGTGGG + Intergenic
983373959 4:166899899-166899921 GATTCTTACCACCAAAATGTAGG + Intronic
996367479 5:122718440-122718462 GAGTCTTACCAAAAGGATATGGG - Intergenic
1001353585 5:170998442-170998464 GAGTCTAACCACAATCATTTTGG - Intronic
1003670452 6:8152920-8152942 CAGTCTTATCACTATGCAGTAGG - Intergenic
1005326989 6:24711876-24711898 GAGTGTAAGCAGTATGATGTAGG - Intronic
1006146226 6:31961418-31961440 GAGCCTTGCCACCAGGATGTGGG + Intronic
1007987028 6:46217166-46217188 GAGTGTTTCCACTCTGAAGTGGG + Intergenic
1009740539 6:67737913-67737935 GAGTCTTACCTCTTGGATTTTGG - Intergenic
1014076611 6:117242620-117242642 GAGTCTTACCTCGATGCTGATGG - Intergenic
1020723712 7:11781934-11781956 GAGTCTTTCCTCTGTGTTGTAGG + Intronic
1031790298 7:126093829-126093851 CAGCCTTAGCACTAGGATGTTGG - Intergenic
1032868279 7:135952010-135952032 AAGTATTCCCACTTTGATGTAGG + Intronic
1034230195 7:149518992-149519014 GAGCCTTTCCACTAAGATCTGGG + Intergenic
1042797086 8:72676374-72676396 GAGTCTTTCCACGATGCTTTTGG - Intronic
1045422786 8:102033001-102033023 GATTCTTTCCAGTATGAAGTGGG + Intronic
1048977062 8:139679044-139679066 GATGCTTACGACTATGAAGTGGG - Intronic
1051147061 9:14038239-14038261 GGGTCTTACCTCTATGTTGATGG + Intergenic
1052014529 9:23449506-23449528 GGGTCTTTCCAATATGATGCAGG - Intergenic
1055741080 9:79390367-79390389 GAGTCTGTCCACTAAAATGTGGG + Intergenic
1059244100 9:112834762-112834784 CAGTCTTTTCACTATAATGTTGG - Intronic
1062520449 9:136955504-136955526 GAGTGTGACCACTATGACCTTGG + Intronic
1203751987 Un_GL000218v1:88528-88550 GAGTCTTACCAGTTTGATACTGG + Intergenic
1186942193 X:14521917-14521939 GAGTCTTGCCTCTATGTTGATGG + Intergenic
1190501784 X:51086297-51086319 GAGTATTCCCAGTATGATTTGGG + Intergenic
1193401641 X:81052790-81052812 GTGTCTTAGCAATATGATGTGGG - Intergenic
1194170152 X:90571246-90571268 GAGTCTTGCCAGTTTGATATTGG - Intergenic
1200516396 Y:4149013-4149035 GAGTCTTGCCAGTTTGATATTGG - Intergenic
1201165646 Y:11206147-11206169 GAGTCTTACCAGTTTGATACTGG + Intergenic