ID: 1107208153

View in Genome Browser
Species Human (GRCh38)
Location 13:37820560-37820582
Sequence TTTACGTTTTTATGTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1697
Summary {0: 1, 1: 0, 2: 13, 3: 286, 4: 1397}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107208153_1107208156 21 Left 1107208153 13:37820560-37820582 CCAGCAGCACATAAAAACGTAAA 0: 1
1: 0
2: 13
3: 286
4: 1397
Right 1107208156 13:37820604-37820626 TTATCCCTGCAATGCAAGATTGG 0: 1
1: 5
2: 110
3: 700
4: 2713
1107208153_1107208154 -4 Left 1107208153 13:37820560-37820582 CCAGCAGCACATAAAAACGTAAA 0: 1
1: 0
2: 13
3: 286
4: 1397
Right 1107208154 13:37820579-37820601 TAAATCCAAAATGATCAAGTAGG 0: 1
1: 0
2: 13
3: 139
4: 1826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107208153 Original CRISPR TTTACGTTTTTATGTGCTGC TGG (reversed) Intronic
901966314 1:12870226-12870248 TAAACTTTTTGATGTGCTGCTGG + Intronic
902678010 1:18022430-18022452 TTTATGTTTTTAGGTGGTGAGGG - Intergenic
904447147 1:30583622-30583644 TAAACTTTTTGATGTGCTGCTGG + Intergenic
904694953 1:32324411-32324433 TTTACATATTTATGAGCTGATGG - Intronic
905100411 1:35516323-35516345 TTAGCTTTTTGATGTGCTGCTGG - Intronic
905711884 1:40111768-40111790 TTAACTTTTTGATGTGCTGCTGG - Intergenic
906049563 1:42859077-42859099 TTGAGGTTTTTGTGTGCTGTAGG - Intergenic
906542257 1:46596351-46596373 TTTACATTTTTATGTGGTTGGGG - Intronic
906836616 1:49089871-49089893 TTAGCTTTTTGATGTGCTGCTGG - Intronic
906895657 1:49768298-49768320 TTAACATTTTGATGTGCAGCTGG - Intronic
907001153 1:50858913-50858935 TTTACTTTTTGATGTGCTGTTGG - Intronic
907549733 1:55294507-55294529 TTCACTTTTTGATGTGCTGCTGG - Intergenic
907591607 1:55678145-55678167 TTAACTTTTTGATGTGCTGCTGG + Intergenic
907656383 1:56346371-56346393 TCAACTTTTTTATGTGCTTCTGG - Intergenic
907793051 1:57686676-57686698 TTAACTTTTATATGTGCTGCTGG - Intronic
908086787 1:60643644-60643666 TAAACTTTTTGATGTGCTGCTGG - Intergenic
908624981 1:66030219-66030241 TAAACCTTTTGATGTGCTGCTGG + Intronic
908664286 1:66472781-66472803 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
908866218 1:68551514-68551536 TATGCTTTTTGATGTGCTGCAGG - Intergenic
908908843 1:69048734-69048756 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
909025118 1:70472601-70472623 TTAGCTTTTTGATGTGCTGCAGG - Intergenic
909060866 1:70877816-70877838 ATTAGGTTTTGTTGTGCTGCTGG + Intronic
909173728 1:72327282-72327304 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
909232067 1:73103912-73103934 TTTATGTTTATAAGTGATGCTGG - Intergenic
909232069 1:73103989-73104011 TTAACTTTCTGATGTGCTGCTGG - Intergenic
909322705 1:74309581-74309603 TTATCCTTTTGATGTGCTGCTGG - Intronic
909369166 1:74863846-74863868 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
909424541 1:75507416-75507438 TTAACTTTTTGATGTGCTACTGG + Intronic
909442561 1:75714154-75714176 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
909485784 1:76172108-76172130 GTTTTTTTTTTATGTGCTGCTGG - Intronic
909816400 1:80000040-80000062 TAAACTTTTTGATGTGCTGCCGG - Intergenic
909870595 1:80733850-80733872 TAAACTTTTTGATGTGCTGCTGG - Intergenic
909886580 1:80949161-80949183 TAAACTTTTTGATGTGCTGCTGG - Intergenic
909938586 1:81584119-81584141 TTTGCTTTTATATGTGCAGCAGG + Intronic
910064547 1:83137727-83137749 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
910254486 1:85234190-85234212 TTAACTTTTTGATGGGCTGCTGG + Intergenic
910339018 1:86164719-86164741 TATGCTTTTTGATGTGCTGCTGG + Intergenic
910379493 1:86610826-86610848 TAAACTTTTTGATGTGCTGCTGG + Intergenic
910454092 1:87377042-87377064 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
910610585 1:89137428-89137450 TTCGCTTTTTAATGTGCTGCTGG - Intronic
910619756 1:89240178-89240200 TTAGCATTATTATGTGCTGCTGG + Intergenic
910645420 1:89508996-89509018 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
910813143 1:91258184-91258206 TTAACTTTTTGATGTGCTGCTGG - Intergenic
911272598 1:95821384-95821406 TTTGCTTTTTCATGTGCTGCTGG + Intergenic
911311241 1:96294482-96294504 TTAACTTTTTGATGTGCTGCTGG + Intergenic
911374893 1:97040301-97040323 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
911690155 1:100823833-100823855 TAAACTTTTTGATGTGCTGCTGG - Intergenic
911691696 1:100841991-100842013 TAAACTTTTTAATGTGCTGCTGG + Intergenic
911736917 1:101347056-101347078 TTAACTTTCTGATGTGCTGCTGG + Intergenic
911812241 1:102297156-102297178 TTTTTTTTTTTCTGTGCTGCTGG + Intergenic
911867537 1:103047971-103047993 TAAGCTTTTTTATGTGCTGCTGG + Intronic
911932368 1:103921675-103921697 TTAACATTTTGATGTGCTGCTGG + Intergenic
911940703 1:104043974-104043996 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
912279749 1:108300679-108300701 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
912288477 1:108393678-108393700 TTAGCTTTTTGATGTGCTGCTGG - Intronic
912558408 1:110532861-110532883 TTTATCTTTTCATTTGCTGCTGG + Intergenic
912613343 1:111071462-111071484 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
912613716 1:111075894-111075916 TAAGCGTTTTGATGTGCTGCTGG + Intergenic
912732435 1:112120361-112120383 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
912857372 1:113181961-113181983 TTAACTTTTTGATGTGCTGCTGG - Intergenic
912884841 1:113460043-113460065 TTACCTTTTTTATGTGCTGTTGG - Intronic
913420709 1:118665309-118665331 TTAACTTTTTGATGTCCTGCTGG - Intergenic
913504237 1:119501424-119501446 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
913663437 1:121025681-121025703 TTATCTTTTTGATGTGCTGCTGG - Intergenic
914014828 1:143808949-143808971 TTATCTTTTTGATGTGCTGCTGG - Intergenic
914162993 1:145152258-145152280 TTATCTTTTTGATGTGCTGCTGG + Intergenic
914202833 1:145501794-145501816 TTAGCTTTTTAATGTGCTGCTGG - Intergenic
914236762 1:145819730-145819752 TTAGCTTTTTAATGTGCTGCTGG - Intronic
914383271 1:147140253-147140275 TTTGCTTTTGGATGTGCTGCTGG + Intergenic
914405685 1:147369688-147369710 TTAACTTTTTAATGTGCTGCTGG - Intergenic
914481956 1:148074945-148074967 TTAGCTTTTTAATGTGCTGCTGG - Intergenic
914653449 1:149717506-149717528 TTATCTTTTTGATGTGCTGCTGG - Intergenic
914972558 1:152323681-152323703 TTTTTTTTTTTATGTACTGCTGG + Intronic
914994427 1:152529595-152529617 TTAGCTTTTTGATGTGCTGCTGG + Intronic
915651874 1:157319056-157319078 TACACTTTTTGATGTGCTGCTGG - Intergenic
915696331 1:157746362-157746384 TTAACTTATTTATGTGCTGCTGG - Exonic
915807366 1:158868481-158868503 TAAACTTTTTGATGTGCTGCTGG - Intergenic
916363864 1:164001239-164001261 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
916593896 1:166223401-166223423 TTAGCTTTTTCATGTGCTGCTGG + Intergenic
916643170 1:166754076-166754098 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
916700809 1:167292778-167292800 TTGTCTTTTTTATGTCCTGCTGG - Intronic
916707000 1:167361540-167361562 TTGACTTTTTGATGTGCTGCTGG + Intronic
916904398 1:169266236-169266258 TTCACTTTTTGATGTGCTGCTGG - Intronic
916916435 1:169411658-169411680 TGAACTTTTTCATGTGCTGCTGG - Intronic
917092080 1:171363309-171363331 TAAACTTTTTGATGTGCTGCTGG - Intergenic
917172975 1:172198284-172198306 TTAGCTTTTTGATGTGCTGCTGG + Intronic
917234901 1:172880982-172881004 TTAACTTTTTGATGTGCTGCTGG + Intergenic
917272413 1:173292256-173292278 TTAACTTTTTGATGTGCTACTGG - Intergenic
917290261 1:173464933-173464955 TAAACTTTTTGATGTGCTGCTGG - Intergenic
917305637 1:173621429-173621451 TAAACTTTTTGATGTGCTGCTGG - Intronic
917714871 1:177724360-177724382 ATTAGCTTTTGATGTGCTGCTGG - Intergenic
917820428 1:178757659-178757681 TTAACTTTTTGGTGTGCTGCTGG + Intronic
918100863 1:181373005-181373027 TTATCTTTTTGATGTGCTGCTGG + Intergenic
918156576 1:181852855-181852877 GATAAGTTTTTTTGTGCTGCTGG - Intergenic
918588586 1:186216217-186216239 TAAACTTTTTGATGTGCTGCTGG - Intergenic
918801873 1:188982937-188982959 TAAACTTTTTGATGTGCTGCTGG + Intergenic
918832215 1:189413004-189413026 TTAGCTTTTTAATGTGCTGCTGG + Intergenic
919015430 1:192027441-192027463 TTAACCTTTTGAGGTGCTGCTGG + Intergenic
919050360 1:192504221-192504243 TAAACTTTTTGATGTGCTGCTGG - Intergenic
919052903 1:192533350-192533372 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
919164459 1:193874643-193874665 TAAACTTTTTGATGTGCTGCTGG - Intergenic
919219564 1:194608885-194608907 TAAACTTTTTGATGTGCTGCTGG + Intergenic
919223513 1:194662667-194662689 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
919260221 1:195183002-195183024 TTAACTTTTTGATGTGCTGCTGG + Intergenic
919283487 1:195521994-195522016 TTTAATTTTTTATATGCTACTGG - Intergenic
919389470 1:196964229-196964251 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
919594223 1:199541802-199541824 TTAACTTTTTAATGTGCTGCTGG - Intergenic
920731757 1:208493298-208493320 TTAACTTTTTGATGTACTGCTGG + Intergenic
920973440 1:210762996-210763018 TTAACTTTTTGATGTGCTGCTGG - Intronic
921004498 1:211079590-211079612 TAAACTTTTTGATGTGCTGCTGG - Intronic
921236816 1:213140704-213140726 TTAGCTTTTTGATGTGCTGCTGG + Intronic
921631614 1:217440135-217440157 TAAACTTTTTGATGTGCTGCTGG - Intronic
921653695 1:217708805-217708827 TTTCCTTTTTAATGTGCTGCTGG - Intronic
921753246 1:218822166-218822188 TAAACTTTTTGATGTGCTGCTGG - Intergenic
921790926 1:219289675-219289697 TTTTCTTTTTCATGAGCTGCTGG + Intergenic
921895947 1:220400759-220400781 TTGACTTTTTGATGTGCTGCTGG + Intergenic
921942787 1:220860480-220860502 TAAACTTTTTGATGTGCTGCTGG + Intergenic
921986524 1:221318471-221318493 TCTATGATTTTATGTTCTGCTGG + Intergenic
922092294 1:222408123-222408145 TAAACTTTTTGATGTGCTGCTGG - Intergenic
923338977 1:232992011-232992033 TTTACGATTTTGTGTGTTGTCGG + Intronic
923452238 1:234129163-234129185 TTTATGTTTTTAAGTCCTGTTGG - Intronic
924388448 1:243523762-243523784 TTTACATTTTCATGTGATGCGGG - Intronic
924630012 1:245728153-245728175 TAAACTTTTTGATGTGCTGCTGG - Intergenic
924691846 1:246359586-246359608 TTATCTTTTTGATGTGCTGCTGG - Intronic
924828679 1:247569574-247569596 TATGCTTTTTAATGTGCTGCTGG + Intronic
924893703 1:248313255-248313277 ATAACCTTTTGATGTGCTGCTGG + Intergenic
924910277 1:248503655-248503677 TTCACTTTTTGATGTGCTGCTGG - Intergenic
924913824 1:248544383-248544405 TTCACTTTTTGATGTGCTGCTGG + Intergenic
1063181975 10:3610768-3610790 TTAACTTTTTGATGTGCTGTTGG - Intergenic
1063617959 10:7618553-7618575 TTTATGTTTTCATGTTCTCCAGG - Intronic
1063625211 10:7682725-7682747 TTAACTTTTTGATGTGCTGTTGG - Intergenic
1064957914 10:20931787-20931809 TTTACATTCTTATGTGCATCTGG + Intronic
1065059656 10:21886596-21886618 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1065499978 10:26370565-26370587 TTAATGTTTTGATGTGCTGTTGG + Intergenic
1066007643 10:31161141-31161163 TAATCTTTTTTATGTGCTGCTGG + Intergenic
1066184947 10:33000743-33000765 TTAACTTTTTGATGTGCTGCTGG + Intronic
1068071520 10:52202413-52202435 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1068238258 10:54267054-54267076 TTATCTTTTTGATGTGCTGCTGG - Intronic
1068264530 10:54629368-54629390 TTAACTTTTTCATGTGCTTCTGG - Intronic
1068271228 10:54728204-54728226 TTAACTTTTTGATATGCTGCTGG - Intronic
1068442735 10:57079607-57079629 ATAACTTTTTGATGTGCTGCTGG + Intergenic
1068449603 10:57168842-57168864 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1068493683 10:57757222-57757244 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1069044488 10:63728148-63728170 TTCACATTTTGATGTGCTGCTGG - Intergenic
1069139586 10:64806804-64806826 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1069264998 10:66446447-66446469 TAAACTTTTTGATGTGCTGCTGG - Intronic
1069277213 10:66607580-66607602 TTTGCTTTTTGATGTGCTGCTGG - Intronic
1069320758 10:67168406-67168428 TTATCTTTTTGATGTGCTGCTGG - Intronic
1069346919 10:67480881-67480903 TTAACTTTTTGATGTGCTACTGG - Intronic
1069356628 10:67594123-67594145 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1069602443 10:69716743-69716765 TGTGCGTTTTTATGTGGTCCAGG + Intergenic
1070459973 10:76655853-76655875 TTAACTTTTTGATGTGCTTCTGG - Intergenic
1070666302 10:78347347-78347369 TATACGCTTTTATATGTTGCTGG + Intergenic
1070870897 10:79751743-79751765 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1071019289 10:81032882-81032904 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1071026157 10:81115892-81115914 GTTACATTTATATGTGATGCTGG - Intergenic
1071058058 10:81533950-81533972 TTTCCATTGTTATGTGCTGATGG - Intergenic
1071059388 10:81551882-81551904 TAAATTTTTTTATGTGCTGCTGG - Intergenic
1071060680 10:81568596-81568618 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1071074926 10:81738675-81738697 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1071192065 10:83112548-83112570 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1071395229 10:85217085-85217107 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1071408978 10:85368393-85368415 TACACTTTTTGATGTGCTGCTGG + Intergenic
1071637824 10:87273954-87273976 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1071657420 10:87463996-87464018 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1071892803 10:90030436-90030458 TTAACTTTTTGATGTGCTGCAGG - Intergenic
1071894216 10:90047445-90047467 TTAACTTTTTTATGTGCTGCAGG + Intergenic
1072393524 10:95014636-95014658 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1072397591 10:95061010-95061032 ATAAGCTTTTTATGTGCTGCTGG + Intronic
1072621025 10:97079331-97079353 TTTACTTTTTGATCTGGTGCTGG + Intronic
1072864711 10:99046103-99046125 TTGACTTTTTAATGTGCTGCTGG - Intronic
1073725167 10:106222011-106222033 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1073999529 10:109355827-109355849 TTAACGTTTTGATGTGCTGCTGG + Intergenic
1074017617 10:109550063-109550085 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1074042394 10:109803976-109803998 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1074612235 10:115033358-115033380 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1074645748 10:115449919-115449941 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1074664341 10:115702043-115702065 TTAACTTTTTGACGTGCTGCTGG - Intronic
1074759024 10:116651291-116651313 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1074933522 10:118154493-118154515 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1075569909 10:123533296-123533318 TTAACTTTTTGATATGCTGCTGG - Intergenic
1075828416 10:125381344-125381366 TTAGCCTTTTGATGTGCTGCTGG + Intergenic
1075936374 10:126345392-126345414 TAAACTTTTTGATGTGCTGCTGG + Intronic
1076340027 10:129738927-129738949 TAAACTTTTTGATGTGCTGCTGG - Intronic
1076506514 10:130977691-130977713 TTATCTTTTTTATGTGTTGCAGG + Intergenic
1077561698 11:3266786-3266808 TGAACTTTTTGATGTGCTGCTGG + Intergenic
1077567592 11:3312606-3312628 TGAACTTTTTGATGTGCTGCTGG + Intergenic
1077763108 11:5125223-5125245 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1077828505 11:5836952-5836974 TTAGCTTTTTCATGTGCTGCTGG + Intronic
1077841391 11:5979081-5979103 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1077953119 11:6983531-6983553 TAAACTTTTTGATGTGCTGCTGG - Intronic
1077984510 11:7337732-7337754 TTAACTTTTTGATGTGCTGCTGG + Intronic
1078119637 11:8493720-8493742 TAAACTTTTTGATGTGCTGCTGG - Intronic
1078295135 11:10060654-10060676 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1078392540 11:10948634-10948656 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1078419025 11:11192489-11192511 TTAGCTTTTTCATGTGCTGCTGG - Intergenic
1078517575 11:12036815-12036837 TTTGCTTTTTGATGTGCTGCTGG - Intergenic
1078684322 11:13513914-13513936 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1078835110 11:15020070-15020092 TAAACTTTTTGATGTGCTGCTGG - Intronic
1079167442 11:18058705-18058727 TAGACTTTTTGATGTGCTGCTGG + Intergenic
1079258859 11:18857789-18857811 ATTAACTTTTGATGTGCTGCTGG - Intergenic
1079337515 11:19583745-19583767 ATAACTTTTTGATGTGCTGCTGG + Intronic
1079462520 11:20695640-20695662 TTAACTTTTTGATGTGCTACTGG + Intronic
1079518119 11:21291699-21291721 TAAACTTTTTGATGTGCTGCTGG - Intronic
1079595696 11:22243282-22243304 TTAACTTTTTGATGTGCTCCTGG + Intronic
1079621837 11:22565211-22565233 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1079736012 11:23998161-23998183 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1079843129 11:25428768-25428790 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1079868237 11:25762070-25762092 ATAAGCTTTTTATGTGCTGCTGG - Intergenic
1079945439 11:26735291-26735313 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1080092495 11:28365044-28365066 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1080205854 11:29727916-29727938 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1080500559 11:32866587-32866609 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1080714239 11:34783056-34783078 TTAACTTTTTGATATGCTGCTGG + Intergenic
1080917787 11:36677499-36677521 TAAACGTTTTGATGTGCTGCTGG - Intergenic
1080933029 11:36833306-36833328 TTAACTTTTTGATGTGCTACAGG + Intergenic
1081095794 11:38933060-38933082 TTAACTATTTGATGTGCTGCTGG + Intergenic
1081159701 11:39736581-39736603 TTGACGTTCTTGTGTGCTGGAGG - Intergenic
1081211771 11:40344274-40344296 TTCACTTTTTAATGTGCTGCTGG - Intronic
1081272276 11:41099465-41099487 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1081293341 11:41353644-41353666 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1081316351 11:41635812-41635834 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1081343956 11:41959767-41959789 TTAGCTTTTTCATGTGCTGCTGG - Intergenic
1081370120 11:42290261-42290283 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1082087746 11:48064135-48064157 TTTTAGTTTTTATGTGGGGCAGG + Intronic
1082109116 11:48253820-48253842 TTAACTTTTTGATATGCTGCTGG + Intergenic
1082124134 11:48412422-48412444 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1082135483 11:48544273-48544295 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1082206286 11:49438653-49438675 TAAACATTTTTATATGCTGCTGG + Intergenic
1082280039 11:50261969-50261991 TTGACGATTTGATGTGCTGGTGG - Intergenic
1082596491 11:55088143-55088165 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1082754547 11:57061235-57061257 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1082755050 11:57066524-57066546 TTTTTTTTTTGATGTGCTGCTGG - Intergenic
1082945433 11:58753604-58753626 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1082966830 11:58974657-58974679 TTAGTGTTTTGATGTGCTGCTGG - Intronic
1083052346 11:59788579-59788601 TCCACAATTTTATGTGCTGCAGG + Intronic
1083097930 11:60271240-60271262 TTAGATTTTTTATGTGCTGCTGG + Intergenic
1083525150 11:63357116-63357138 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1084200887 11:67557414-67557436 TTTACCTTTTTATATGCTTAAGG + Intergenic
1084467150 11:69330948-69330970 ATTATTTTTTTATGTGTTGCTGG + Intronic
1085222404 11:74885836-74885858 TAAACTTTTTGATGTGCTGCTGG - Intronic
1085336002 11:75696254-75696276 TTAACTTTTTGATGTGCTACTGG + Intergenic
1085487536 11:76879774-76879796 TTATCCTTTTTATGTGTTGCTGG + Intronic
1085536203 11:77220573-77220595 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1085888385 11:80548049-80548071 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1085901526 11:80705645-80705667 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1085995217 11:81903801-81903823 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1086142513 11:83514895-83514917 TATGCTTTTTGATGTGCTGCTGG + Intronic
1086225836 11:84507839-84507861 TTAACTTTTTGATGTGCTGCTGG + Intronic
1086266590 11:85006092-85006114 TAAGCTTTTTTATGTGCTGCTGG + Intronic
1086293107 11:85333796-85333818 TTTGAATTTTGATGTGCTGCTGG + Intronic
1086505972 11:87504653-87504675 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1086523148 11:87694879-87694901 TTAACTTTTCTATGTGCTGCTGG + Intergenic
1086523703 11:87700464-87700486 ATAAGCTTTTTATGTGCTGCTGG + Intergenic
1086531716 11:87794232-87794254 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1086532013 11:87797613-87797635 TACACTTTTTGATGTGCTGCTGG - Intergenic
1086560162 11:88158547-88158569 TTCACTTTTTCATGTGCTGTTGG - Intronic
1086563363 11:88195051-88195073 TTACCTTTTTGATGTGCTGCTGG + Intergenic
1086648981 11:89263128-89263150 TAAACATTTTTATATGCTGCTGG - Intronic
1086792386 11:91058685-91058707 ATAAGTTTTTTATGTGCTGCTGG - Intergenic
1086811721 11:91318658-91318680 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1086914712 11:92516261-92516283 TACACTTTTTGATGTGCTGCTGG - Intronic
1087072608 11:94096389-94096411 TAAACTTTTTGATGTGCTGCTGG + Intronic
1087154822 11:94890957-94890979 TTATCTTTTTGATGTGCTGCTGG + Intergenic
1087387076 11:97485180-97485202 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1087575063 11:99979514-99979536 TTTATGTTTTTGTGTGAGGCAGG + Intronic
1087606960 11:100388558-100388580 TACACTTTTTGATGTGCTGCTGG - Intergenic
1087731881 11:101788019-101788041 TTCATGTTTTTATGTGATGAAGG + Intronic
1087910401 11:103746369-103746391 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1087916465 11:103817178-103817200 ATAAGCTTTTTATGTGCTGCTGG + Intergenic
1088079814 11:105897777-105897799 TTATCTTTTTGATGTGCTGCTGG + Intronic
1088236953 11:107735375-107735397 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1088425768 11:109700222-109700244 TTAACTTTCTGATGTGCTGCTGG - Intergenic
1088506056 11:110528492-110528514 TTAGCCTTTCTATGTGCTGCTGG + Intergenic
1088730148 11:112673058-112673080 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1088733247 11:112702940-112702962 TCAACTTTTTGATGTGCTGCTGG - Intergenic
1088771404 11:113039286-113039308 TTTACTTATTAATGTGCTGCAGG + Intronic
1089593961 11:119563879-119563901 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1089741131 11:120584922-120584944 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1089885086 11:121813002-121813024 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1090319548 11:125830509-125830531 TTTACATTTTTGAGTGATGCTGG - Intergenic
1090729878 11:129561478-129561500 TTAATTTTTTTATGTGCTGCTGG - Intergenic
1090864338 11:130684261-130684283 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1091031598 11:132194240-132194262 TTAACTTTTTGATGTGTTGCTGG - Intronic
1091151482 11:133332822-133332844 TTTGCTTTTTAATGTGTTGCTGG + Intronic
1091708387 12:2716963-2716985 TTAACTTTTTGAGGTGCTGCTGG - Intergenic
1091709680 12:2730202-2730224 TTAACCTTTTGATGTGCTGCTGG + Intergenic
1092326029 12:7532262-7532284 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1092393857 12:8107243-8107265 TTAACTTTTTGATGTGCTACTGG + Intergenic
1092516242 12:9217135-9217157 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1092639255 12:10485443-10485465 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1092643201 12:10539108-10539130 TTAACTTTTTGATATGCTGCTGG - Intergenic
1092678995 12:10956197-10956219 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1092680705 12:10977188-10977210 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1092906969 12:13109818-13109840 TTAACTTTTTGATGTACTGCTGG + Intronic
1093100808 12:15026666-15026688 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1093309475 12:17561468-17561490 ATAAGGTTTTGATGTGCTGCTGG + Intergenic
1093329435 12:17816897-17816919 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1093615352 12:21215545-21215567 TTCACTTTTTGATGTGCTGCTGG + Intronic
1093618609 12:21259379-21259401 TACACTTTTTGATGTGCTGCTGG + Intergenic
1094206691 12:27847951-27847973 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1094222121 12:28005388-28005410 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1094297078 12:28919021-28919043 TTAACTTTTTGATCTGCTGCTGG - Intergenic
1094312142 12:29095937-29095959 TAAGCGTTTTGATGTGCTGCTGG - Intergenic
1094790942 12:33914390-33914412 TTAGCTTTTTAATGTGCTGCTGG + Intergenic
1094798841 12:34006435-34006457 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1094816830 12:34195351-34195373 TTACCCTTTTGATGTGCTGCTGG - Intergenic
1095100217 12:38173822-38173844 TTACCCTTTTGATGTGCTGCTGG + Intergenic
1095104094 12:38210966-38210988 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1095111592 12:38300507-38300529 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1095571535 12:43688272-43688294 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1095625871 12:44314462-44314484 TTAACTTTTTGATATGCTGCTGG + Intronic
1095823998 12:46512463-46512485 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1096032064 12:48427445-48427467 TTCGCTTTTTAATGTGCTGCTGG + Intergenic
1096032997 12:48437524-48437546 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1096034293 12:48451106-48451128 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1096042795 12:48533482-48533504 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1096346695 12:50854098-50854120 ATTAGTTTTTGATGTGCTGCTGG - Intronic
1096925492 12:55139990-55140012 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1096942840 12:55367275-55367297 TTATCTTTTTGATGTGCTGCTGG - Intergenic
1097482764 12:60151177-60151199 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1097586163 12:61518887-61518909 TATATGTTTTTATGTGAGGCAGG - Intergenic
1097916767 12:65029243-65029265 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1098224219 12:68304937-68304959 TTATCTTTTTGATGTGCTGCTGG + Intronic
1098252241 12:68582228-68582250 TTTAAGTTTCTATGTGCTTCAGG + Intergenic
1098327769 12:69320384-69320406 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1098347557 12:69522095-69522117 TTCACTTTTTGGTGTGCTGCTGG + Intronic
1098371512 12:69765506-69765528 TTAACTTTTTGATGTGCTGTTGG + Intronic
1098401489 12:70081200-70081222 TTAATATTTTTATGTGGTGCTGG - Intergenic
1098512738 12:71337544-71337566 GTAACTTTTTGATGTGCTGCTGG - Intronic
1098699773 12:73609455-73609477 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1098791467 12:74829709-74829731 TTACCTTTTTGATGTGCTGCTGG + Intergenic
1099082096 12:78196987-78197009 TATACTTTTATATTTGCTGCAGG + Intronic
1099185107 12:79507463-79507485 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1099301399 12:80899349-80899371 TTAACTTTTTGATGTGATGCTGG + Intronic
1099327876 12:81242631-81242653 TAAACTTTTTGATGTGCTGCTGG - Intronic
1099398075 12:82166659-82166681 TTAACTTTTTGATATGCTGCTGG + Intergenic
1099497872 12:83375082-83375104 TTAAATTTTTGATGTGCTGCTGG + Intergenic
1099511706 12:83546735-83546757 TAAACTTTTTAATGTGCTGCTGG + Intergenic
1099561936 12:84189819-84189841 TTTACCTTTTAATGTGATGTTGG - Intergenic
1099572747 12:84345671-84345693 TTAACTTTTTGATGTGCTACTGG + Intergenic
1099667418 12:85650044-85650066 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1099688003 12:85913838-85913860 TTTATGTGTTTAGGTGATGCTGG - Intergenic
1099706453 12:86159389-86159411 TTAACATTTTGATGTGCTGCTGG + Intronic
1099767321 12:87004347-87004369 TTAATTTTTTGATGTGCTGCTGG + Intergenic
1100146489 12:91683960-91683982 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1100564165 12:95778931-95778953 TAAGCGTTTTGATGTGCTGCTGG - Intronic
1100630356 12:96382633-96382655 TTAACATTTTGATGTGCTGCTGG - Intronic
1100637723 12:96451075-96451097 TTATCTTTTTGATGTGCTGCTGG - Intergenic
1100740430 12:97585462-97585484 TAAACTTTTTAATGTGCTGCTGG - Intergenic
1101299655 12:103465965-103465987 TAAACTTTTTGATGTGCTGCTGG + Intronic
1101596200 12:106167212-106167234 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1104042136 12:125137486-125137508 TTAACTTTTTAAAGTGCTGCTGG + Intronic
1104082252 12:125440036-125440058 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1104156000 12:126132958-126132980 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1104225266 12:126826082-126826104 TTAACTTTTTGATGTGCAGCTGG + Intergenic
1104226097 12:126835279-126835301 TTAACATTTTGATGTGCTGCTGG + Intergenic
1104632498 12:130415174-130415196 TTGTCTTTTTGATGTGCTGCTGG - Intronic
1104677584 12:130724031-130724053 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1105320131 13:19311685-19311707 TTAACTTTTTGATGTGTTGCTGG + Intergenic
1105569927 13:21592638-21592660 TAAACTTTTTGATGTGCTGCTGG - Intronic
1107155261 13:37158941-37158963 TTAACTTTTTTATGTGCTGATGG + Intergenic
1107157696 13:37188942-37188964 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1107208153 13:37820560-37820582 TTTACGTTTTTATGTGCTGCTGG - Intronic
1107296946 13:38919405-38919427 ATAACTTTTTGATGTGCTGCTGG + Intergenic
1107309168 13:39058429-39058451 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1107310958 13:39077194-39077216 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1107333824 13:39331993-39332015 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1107484980 13:40817524-40817546 TTAACTTATTGATGTGCTGCTGG - Intergenic
1107487472 13:40843015-40843037 TTAACTTTTTAATGTGCTGTTGG - Intergenic
1107551118 13:41476710-41476732 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1107641473 13:42447812-42447834 TTTATTTTTTAACGTGCTGCTGG - Intergenic
1107641664 13:42450093-42450115 ATTCTTTTTTTATGTGCTGCTGG - Intergenic
1107763942 13:43713281-43713303 TGAACTTTTTGATGTGCTGCTGG + Intronic
1108031832 13:46239774-46239796 TAAACTTTTTGATGTGCTGCTGG - Intronic
1108160746 13:47636070-47636092 TAAATGTTTTGATGTGCTGCTGG - Intergenic
1108426440 13:50306495-50306517 TTAACTTTTTGATGTGCTGCTGG + Intronic
1108547657 13:51512072-51512094 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1108626967 13:52239326-52239348 TTAACTTTTTGATGTGCTGTTGG - Intergenic
1108659098 13:52567135-52567157 TTAACTTTTTGATGTGCTGTTGG + Intergenic
1108865223 13:54914929-54914951 TTAACTTTTTAATGTGCTGCTGG - Intergenic
1109095078 13:58103912-58103934 GTTAGTTTTTTATGTGCTACTGG + Intergenic
1109291230 13:60477740-60477762 TTAACTTTTTGATGTGCTGCTGG + Intronic
1109308778 13:60668134-60668156 TTAACACTTTGATGTGCTGCTGG + Intergenic
1109317055 13:60762309-60762331 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1109377629 13:61518625-61518647 TTTATTTTTTTATGTGCTGTGGG - Intergenic
1109385572 13:61625347-61625369 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1109450605 13:62509297-62509319 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1109531519 13:63654802-63654824 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1109598758 13:64594730-64594752 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1109620956 13:64904427-64904449 TTAACTTTTTGATGTGCTGTAGG - Intergenic
1109625908 13:64974086-64974108 TTAGCTTTTTCATGTGCTGCTGG + Intergenic
1109869330 13:68312305-68312327 ATAACTTTTTGATGTGCTGCTGG - Intergenic
1109902462 13:68792331-68792353 TAAGCGTTTTGATGTGCTGCTGG + Intergenic
1109928236 13:69176641-69176663 TTAACTTTTTTATGTGCTAATGG - Intergenic
1110069015 13:71149430-71149452 TTTATGTTGTTATGTGTGGCTGG - Intergenic
1110129158 13:71985359-71985381 TTAACTTTGTGATGTGCTGCTGG - Intergenic
1110266183 13:73540495-73540517 ATTACTTTTTTATATGTTGCTGG + Intergenic
1110397149 13:75044039-75044061 TTAACTTTCTCATGTGCTGCTGG - Intergenic
1110402656 13:75111949-75111971 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1110481912 13:75988331-75988353 TTACCTTTTTAATGTGCTGCTGG - Intergenic
1110492072 13:76121263-76121285 ATAACTTTTTAATGTGCTGCTGG - Intergenic
1110730209 13:78871700-78871722 TTAACCTTGTAATGTGCTGCAGG + Intergenic
1110866643 13:80403815-80403837 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1110877122 13:80523650-80523672 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1110942400 13:81366605-81366627 TACACTTTTTGATGTGCTGCTGG - Intergenic
1111000459 13:82172833-82172855 TTCACTTTTTGATGTGCTGCTGG - Intergenic
1111074195 13:83211209-83211231 TTACCTTTTTGATGTGCTGCTGG - Intergenic
1111077239 13:83253030-83253052 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1111209528 13:85059771-85059793 TTTATGTTTTTGTGTTCTGTTGG - Intergenic
1111366245 13:87249534-87249556 TTAACTTTTTGATGTGCAGCTGG - Intergenic
1112223103 13:97511460-97511482 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1112706210 13:102071962-102071984 TTTACTTTTTTATATGCTGGGGG - Intronic
1113227229 13:108172545-108172567 TTCGCTTTTTGATGTGCTGCTGG - Intergenic
1113234348 13:108253502-108253524 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1113528055 13:110997321-110997343 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1114132175 14:19803603-19803625 TTAGAGTTTTAATGTGCTGCTGG + Intronic
1114361389 14:21977168-21977190 TTAACTTTTTGATGTACTGCTGG + Intergenic
1114785508 14:25592887-25592909 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1114907327 14:27146618-27146640 TTAACTTTTGGATGTGCTGCTGG + Intergenic
1114933327 14:27503282-27503304 TTCACTTTTTGATGTGCTGCTGG + Intergenic
1114991137 14:28291628-28291650 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1115009953 14:28533977-28533999 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1115017043 14:28630057-28630079 TTAATTTTTTGATGTGCTGCTGG + Intergenic
1115045055 14:28981664-28981686 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1115156418 14:30344548-30344570 TTAACTTTTTGATGTGCTGTTGG + Intergenic
1115295021 14:31815903-31815925 TAAGCTTTTTTATGTGCTGCTGG + Intronic
1115392013 14:32864690-32864712 TTAAGTTTTTGATGTGCTGCTGG + Intergenic
1115774060 14:36696276-36696298 TAAACTTTTTGATGTGCTGCTGG + Intronic
1115815374 14:37158354-37158376 TTATCTTTTTGATGTGCTGCTGG - Intronic
1115911607 14:38263037-38263059 ATTAATTTTTGATGTGCTGCTGG - Intergenic
1115924548 14:38416252-38416274 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1115939988 14:38598199-38598221 TAAGCGTTTTGATGTGCTGCTGG + Intergenic
1115947739 14:38681891-38681913 TTTTTTTTTTTATGTGCTGTTGG + Intergenic
1116077946 14:40135918-40135940 TTTGCTTTTTTGTTTGCTGCTGG + Intergenic
1116108438 14:40543135-40543157 GTTACTTTTTGATGTGCCGCTGG + Intergenic
1116222546 14:42107303-42107325 TTAACTTTTTGATGTGCTTCTGG + Intergenic
1116472523 14:45302569-45302591 TTATCTTTTTGATGTGCTGCTGG + Intergenic
1116493128 14:45529123-45529145 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1116511481 14:45752392-45752414 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1116765502 14:49065571-49065593 TAAACCTTTTGATGTGCTGCTGG - Intergenic
1116771105 14:49128210-49128232 ATGAGGTTTTGATGTGCTGCTGG + Intergenic
1116782808 14:49254681-49254703 TTTGCTTTTTGATGTGCTGCTGG - Intergenic
1116931960 14:50699769-50699791 TTTGCTTTTGGATGTGCTGCTGG + Intergenic
1116985592 14:51215978-51216000 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1117188132 14:53262795-53262817 TTATCTTTTTAATGTGCTGCTGG + Intergenic
1117188637 14:53268777-53268799 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1117202034 14:53400507-53400529 TTGATGTTATTCTGTGCTGCTGG + Intergenic
1117502001 14:56361957-56361979 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1117624808 14:57624577-57624599 TAAACTTTTTGATGTGCTGCTGG - Intronic
1117639229 14:57779705-57779727 TTAGCTTTTTCATGTGCTGCTGG - Intronic
1117786088 14:59287058-59287080 TTAACTTTTTGATGTGCTGCTGG - Intronic
1117820958 14:59648560-59648582 TTAACTTCTTGATGTGCTGCTGG - Intronic
1117829575 14:59736800-59736822 TAAACTTTTTGATGTGCTGCTGG - Intronic
1117849720 14:59955011-59955033 TAAACTTTTTGATGTGCTGCTGG + Intronic
1117936262 14:60910693-60910715 TAAACTTTTTGATGTGCTGCTGG + Intronic
1117957090 14:61131131-61131153 TTTAGCTCTTTATGTGGTGCCGG + Intergenic
1118114895 14:62764148-62764170 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1118215694 14:63806348-63806370 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1118226591 14:63906172-63906194 TTAACTTTTTTATGTGCTGCTGG + Intronic
1118233687 14:63979183-63979205 TTTACTCTTTCCTGTGCTGCTGG - Intronic
1118426268 14:65666797-65666819 TTAACTTTTTGATATGCTGCTGG - Intronic
1118463947 14:66013935-66013957 TTAAAGTTTTTATGTCCTACCGG + Intergenic
1118494874 14:66298235-66298257 TATGCTTTTTGATGTGCTGCTGG - Intergenic
1118498792 14:66336547-66336569 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1118522952 14:66607338-66607360 TTAACTTTTTAATGTGCTGCTGG + Intronic
1118646200 14:67843038-67843060 TTAACTTTTTGATGTGTTGCTGG + Intronic
1118660443 14:68003882-68003904 TAAACTTTTTGATGTGCTGCTGG + Intronic
1118701403 14:68437376-68437398 TTAACTTTTTTATGTACTACTGG + Intronic
1120279110 14:82416716-82416738 ATTACATTTTGATGTGCTGCTGG + Intergenic
1120283464 14:82467628-82467650 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1120448692 14:84637343-84637365 TTAAATTTTTTATGTGCTGCTGG + Intergenic
1120455369 14:84723432-84723454 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1120565002 14:86044699-86044721 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1120619592 14:86747397-86747419 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1120625028 14:86814400-86814422 TTAACTTTTTCATGTGCCGCTGG + Intergenic
1120774121 14:88413920-88413942 TTAACTTTTTGATGTGCTGTTGG + Intronic
1120960389 14:90119416-90119438 ATTAGTTTTTGATGTGCTGCTGG - Intronic
1121479195 14:94247685-94247707 TTAACTTTTTGATGTGCTACTGG - Intronic
1122259724 14:100508046-100508068 TTAACTTTTTGATGTGCTGCTGG - Intronic
1123392615 15:19891949-19891971 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1123455840 15:20424202-20424224 TTAACTGTTTTATATGCTGCTGG + Intergenic
1123575534 15:21663610-21663632 TTAACTTTTTGATGTGCTGATGG - Intergenic
1123612154 15:22106082-22106104 TTAACTTTTTGATGTGCTGATGG - Intergenic
1123635729 15:22306644-22306666 TTAACTGTTTTATATGCTGCTGG - Intergenic
1123780727 15:23625011-23625033 TTATCCTTTTGATGTGCTGCTGG + Intronic
1123796428 15:23775744-23775766 TTAACTTTTTGATGTGCTGTTGG + Intergenic
1124057153 15:26252415-26252437 TCTACGTTTTTGTGTTCTACAGG - Intergenic
1124923877 15:34052120-34052142 TAAACTTTTTGATGTGCTGCTGG - Intronic
1124935833 15:34169712-34169734 ATAAGGTTTTGATGTGCTGCTGG - Intronic
1125247954 15:37663436-37663458 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1125288862 15:38123495-38123517 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1125384156 15:39118901-39118923 TTAACTTTTTGATGTGCTGTGGG - Intergenic
1125400218 15:39294389-39294411 ATTAGCTTTTGATGTGCTGCTGG + Intergenic
1125408470 15:39379734-39379756 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1125437072 15:39657726-39657748 TTTTCATTTTTATGTCCTCCAGG - Intronic
1125846732 15:42862358-42862380 TTAACTTTTGGATGTGCTGCTGG - Intronic
1126239810 15:46428678-46428700 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1126287564 15:47030990-47031012 TTAACTTTTTGATGTGCTACTGG - Intergenic
1126365814 15:47893226-47893248 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1126471174 15:49012643-49012665 TTTACCTTTTTAAGTGCTGTGGG + Exonic
1126518597 15:49562624-49562646 TTCACATTTTGATGTACTGCTGG - Intronic
1127021436 15:54753031-54753053 TGTGCTTTTTGATGTGCTGCTGG - Intergenic
1127042703 15:54994580-54994602 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1127049646 15:55067605-55067627 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1127100512 15:55559811-55559833 TAAACTTTTTGATGTGCTGCTGG - Intronic
1127202614 15:56672546-56672568 TAAACTTTTTGATGTGCTGCTGG + Intronic
1127330700 15:57936844-57936866 TTAGCTTTTTTATGTGCTGCTGG + Intergenic
1127355686 15:58197168-58197190 TAAACTTTTTGATGTGCTGCTGG - Intronic
1127616679 15:60693073-60693095 TTTGTTTTTTGATGTGCTGCTGG - Intronic
1127813898 15:62589674-62589696 ATTATGATTTTAGGTGCTGCAGG + Exonic
1128654947 15:69453625-69453647 TTGACGTTTTTATTTGTTGTAGG + Exonic
1128782535 15:70371541-70371563 ATAAGCTTTTTATGTGCTGCTGG - Intergenic
1128803231 15:70510547-70510569 TTGACTTTTTTGTGTGCTGTTGG - Intergenic
1129568472 15:76651897-76651919 TTAACTTTTTAATGTGCTGCTGG - Intronic
1130248385 15:82275549-82275571 TTAACTTTTTGATGTGCTGCTGG - Intronic
1130451964 15:84064260-84064282 TTAACTTTTTGATTTGCTGCTGG + Intergenic
1130751889 15:86721272-86721294 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1130810636 15:87374448-87374470 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1131585261 15:93685853-93685875 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1131618202 15:94038684-94038706 TTTGCTTTTTGATGTACTGCTGG - Intergenic
1131639796 15:94279969-94279991 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1132033595 15:98459845-98459867 TTTCCTTTTTTAACTGCTGCTGG - Intronic
1132245129 15:100289639-100289661 ATTAGGTTTTGATGTGTTGCTGG - Intronic
1132334136 15:101033161-101033183 TTTACGTATTTATGGGGTACAGG + Intronic
1202984402 15_KI270727v1_random:397855-397877 TTAACTTTTTGATGTGCTGATGG - Intergenic
1135226677 16:20665758-20665780 TTAACTTTTTGATGTGCTGCAGG - Intronic
1135261892 16:20988209-20988231 TTTAAGTTTAAATTTGCTGCAGG - Intronic
1136650926 16:31669821-31669843 TTTACTTTTTGATCTGCTGCTGG + Intergenic
1137296715 16:47101074-47101096 TATGCTTTTTGATGTGCTGCTGG - Intronic
1137808876 16:51333564-51333586 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1138776808 16:59733188-59733210 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1138866547 16:60828379-60828401 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1138906551 16:61341873-61341895 ATTACCATTTTATGTGCTGTTGG - Intergenic
1139061568 16:63259508-63259530 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1139342895 16:66281147-66281169 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1140998361 16:80283566-80283588 TTAACTTTTTGATGTGGTGCTGG - Intergenic
1141211318 16:81982694-81982716 ATTAACTTTTGATGTGCTGCTGG - Intergenic
1141918593 16:87119534-87119556 TGTAAGTTTTTATTTGCTTCAGG - Intronic
1142896821 17:2985331-2985353 TCTACGTATTTATGGGCTGCTGG + Intronic
1142906101 17:3042974-3042996 TGTACATTTTTATGTGGAGCTGG - Intergenic
1142935697 17:3329079-3329101 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1143915331 17:10287894-10287916 TTTACTTTTTGATGTACTGCTGG + Intergenic
1146420483 17:32680629-32680651 TAAACTTTTTGATGTGCTGCTGG + Intronic
1146614217 17:34339658-34339680 TTAGCTTTTTCATGTGCTGCTGG + Intergenic
1146752835 17:35397564-35397586 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1147049634 17:37783050-37783072 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1147461377 17:40572351-40572373 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1148525845 17:48333338-48333360 TTTACATTTTTATTTAATGCTGG - Intronic
1148994335 17:51696033-51696055 TTAACTTTTTAATGTGCTGCTGG + Intronic
1149021100 17:51965481-51965503 TTAACTTTTTGATGTGCTGCTGG - Intronic
1149062583 17:52440537-52440559 TTGTCTTTTTTATGTGCTGCTGG - Intergenic
1149136915 17:53377969-53377991 TTAACTTTTTGATGTGCTGTTGG + Intergenic
1149160129 17:53683208-53683230 TTAGCCTTTTTATGTGCTGCTGG + Intergenic
1149166500 17:53758535-53758557 GTTTCTTTTTGATGTGCTGCTGG + Intergenic
1149362296 17:55908575-55908597 TTTTTTTTTTAATGTGCTGCTGG + Intergenic
1149405166 17:56341674-56341696 TATACTTTTTGATGTGCTGCTGG + Intronic
1150025038 17:61665466-61665488 TATGCTTTTTAATGTGCTGCTGG + Intergenic
1150176936 17:63066919-63066941 ATTAAGTTTTTATGAGCTCCTGG + Intronic
1150517838 17:65832979-65833001 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1150881831 17:69038340-69038362 TAAACTTTTTGATGTGCTGCTGG - Intronic
1150948240 17:69771562-69771584 TTAACATTTTCATGTGCTGCTGG - Intergenic
1151069928 17:71197497-71197519 TTAGCTTCTTTATGTGCTGCTGG - Intergenic
1151122894 17:71812291-71812313 TTTGCTTTTTTAAATGCTGCTGG - Intergenic
1151394068 17:73808979-73809001 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1151992652 17:77587352-77587374 TTATCTTTTTGATGTGCTGCTGG + Intergenic
1203169236 17_GL000205v2_random:132329-132351 TGAACTTTTTAATGTGCTGCTGG - Intergenic
1153083798 18:1259649-1259671 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1153085554 18:1281951-1281973 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1153108524 18:1557072-1557094 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1153176013 18:2374135-2374157 TTATCTTTTTTATGTGCTGTTGG + Intergenic
1153371724 18:4324640-4324662 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1153957174 18:10107301-10107323 TTAACTTTTTGATGTGCTGTTGG + Intergenic
1154061092 18:11061029-11061051 ATAAGCTTTTTATGTGCTGCTGG - Intronic
1154098827 18:11448757-11448779 TTAATATTTTGATGTGCTGCTGG - Intergenic
1154184382 18:12169500-12169522 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1154320335 18:13345450-13345472 TAAACTTTTTGATGTGCTGCTGG + Intronic
1154358963 18:13643277-13643299 TTCATGTTTTTAGGTGCGGCGGG + Intronic
1154371744 18:13769517-13769539 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1155027331 18:21953567-21953589 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1155614652 18:27707440-27707462 TTAACTTTTTGATATGCTGCTGG + Intergenic
1155708918 18:28851333-28851355 ATTAGTTTTTGATGTGCTGCTGG - Intergenic
1155768475 18:29668264-29668286 TTAACTTTTTGATGTGCAGCTGG - Intergenic
1155769310 18:29676665-29676687 TTAACTTTTTGATTTGCTGCTGG - Intergenic
1156061169 18:33078057-33078079 TTAGCCTTTTGATGTGCTGCTGG - Intronic
1156084114 18:33378804-33378826 TTAACTTTTTGATGTGCTGCTGG + Intronic
1156096248 18:33535797-33535819 TTATCTTTTTGATGTGCTGCTGG - Intergenic
1156529591 18:37802272-37802294 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1156664986 18:39393852-39393874 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1156886857 18:42145131-42145153 TTAACTTTTTGATGTGTTGCTGG - Intergenic
1156956722 18:42975389-42975411 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1157018295 18:43746007-43746029 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1157053958 18:44202714-44202736 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1158127093 18:54112646-54112668 TTCACTTTTTGATGTGCTGTTGG + Intergenic
1158146106 18:54314340-54314362 TTAACTTTTTGATGTTCTGCTGG + Intronic
1158147428 18:54331859-54331881 TTTACGGTTTGATTTGTTGCAGG - Exonic
1158657269 18:59349607-59349629 TTTACAATTTTATCTGCAGCTGG + Intronic
1158790791 18:60778164-60778186 TTGACATTTTTATGTGTTGCTGG - Intergenic
1159096884 18:63912646-63912668 TTAACTTTTTGATATGCTGCTGG + Intronic
1159320611 18:66842695-66842717 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1159403807 18:67974002-67974024 TTTGCCTTTTGATGTGCTCCTGG + Intergenic
1159480585 18:68986266-68986288 TTAACTTTTTGATGTGCTGCTGG - Intronic
1159486165 18:69060261-69060283 TTAATTTTTTGATGTGCTGCTGG + Intergenic
1159486311 18:69062778-69062800 TTAACTTTTTAATGTACTGCTGG - Intergenic
1159515905 18:69457833-69457855 TTAACTTTTTGATGTGCTGCTGG - Intronic
1159564603 18:70034324-70034346 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1159606738 18:70482272-70482294 TTAGCCTTTTGATGTGCTGCTGG + Intergenic
1159660583 18:71091254-71091276 TAAACTTTTTAATGTGCTGCTGG + Intergenic
1159679586 18:71331310-71331332 TTAACTTTTAGATGTGCTGCTGG - Intergenic
1159723564 18:71924234-71924256 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1159735798 18:72096196-72096218 TTAACTTTTTGTTGTGCTGCTGG + Intergenic
1159876804 18:73821454-73821476 ATAAGCTTTTTATGTGCTGCTGG + Intergenic
1160250140 18:77196158-77196180 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1161404470 19:4083953-4083975 TTTACGTTTTTGTTTGAGGCAGG - Intergenic
1162401890 19:10451412-10451434 TTTATGCTTTTATGGTCTGCGGG + Intronic
1163955067 19:20630147-20630169 TAAGCTTTTTTATGTGCTGCTGG + Intronic
1164077216 19:21830875-21830897 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1164140369 19:22454832-22454854 TTAACTTTTTGATGTGCTTCTGG + Intronic
1164213313 19:23119400-23119422 TTAGCTTTTTAATGTGCTGCTGG + Intronic
1164225449 19:23241518-23241540 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1164271469 19:23676478-23676500 TTAACTTTTTGATGTGCTGCTGG - Intronic
1164420878 19:28091395-28091417 TATGCTTTTTGATGTGCTGCTGG - Intergenic
1165165687 19:33853914-33853936 TTTTTTTTTTCATGTGCTGCTGG - Intergenic
1165606139 19:37106384-37106406 TAAACTTTTTGATGTGCTGCTGG + Intronic
1166908074 19:46128712-46128734 ATTAGCTTTTCATGTGCTGCTGG + Intergenic
1167520759 19:49953208-49953230 TTCAGGTTTTGTTGTGCTGCTGG - Intronic
1168199241 19:54802576-54802598 TTCACTTTTTGATATGCTGCGGG + Intronic
1202653688 1_KI270707v1_random:29452-29474 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
925301539 2:2817246-2817268 TAAACTTTTTGATGTGCTGCTGG + Intergenic
926480032 2:13381012-13381034 TTAACCGTTTTATATGCTGCTGG - Intergenic
926538317 2:14142259-14142281 TTTACCTTTTTATCTTTTGCTGG - Intergenic
926804819 2:16698062-16698084 TTATCTTTTTGATGTGCTGCTGG + Intergenic
926928672 2:18014372-18014394 TAAGCGTTTTGATGTGCTGCTGG + Intronic
926995747 2:18733943-18733965 ATAAGCTTTTTATGTGCTGCTGG - Intergenic
927016240 2:18965040-18965062 ATAAGCTTTTTATGTGCTGCTGG - Intergenic
927366751 2:22305719-22305741 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
928041259 2:27880047-27880069 TTCGCTTTTTGATGTGCTGCTGG - Intronic
928142522 2:28742670-28742692 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
928147918 2:28797140-28797162 TTAACTTTTTGATGTGTTGCTGG + Intronic
928461821 2:31481687-31481709 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
928478767 2:31658984-31659006 TTAACTTTTTGATGTGCTGCTGG - Intergenic
928501172 2:31897585-31897607 TATGCGTTTTGATGTGCTGCTGG + Intronic
928608865 2:32971661-32971683 TTAAATTTTTGATGTGCTGCTGG + Intronic
928943013 2:36746174-36746196 TTAGCTTTTTGATGTGCTGCTGG + Intronic
929257383 2:39827338-39827360 TAAACTTTTTAATGTGCTGCTGG + Intergenic
929279500 2:40062529-40062551 CTTACCTTGTTATGTGCTGTAGG + Intergenic
929572679 2:43032467-43032489 TTCAGCTTTTTATGAGCTGCAGG + Intergenic
930188110 2:48430007-48430029 TCTACGTCTTTATGTGATACTGG + Intergenic
930628201 2:53722449-53722471 TTAACTTTTTGATGTGTTGCTGG - Intronic
930900338 2:56498952-56498974 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
930926125 2:56820215-56820237 TAAACTTTTTGATGTGCTGCTGG - Intergenic
930928950 2:56857441-56857463 TTTGCTTTTTGTTGTGCTGCTGG + Intergenic
930930667 2:56877829-56877851 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
931134410 2:59380527-59380549 TTTTCTTTTTGATGTGCTGTTGG - Intergenic
931501949 2:62878589-62878611 TTAGCATTTTGATGTGCTGCTGG - Intronic
931532803 2:63235621-63235643 TTGACTTTTTAATTTGCTGCTGG - Intronic
931545919 2:63387255-63387277 TTTTCATTTTGATGTGCTGCTGG - Intronic
931549634 2:63428358-63428380 TTAACTTTTTGATGTACTGCTGG - Intronic
931624748 2:64247067-64247089 TTTAGGTTTATATTTGCTTCTGG + Intergenic
931889717 2:66658170-66658192 TAAACTTTTTGATGTGCTGCTGG + Intergenic
932105803 2:68941068-68941090 TTAACTTTTTGATATGCTGCTGG + Intergenic
932109548 2:68984148-68984170 TTTGCATTTTTATATGCTGATGG - Intergenic
932371716 2:71195096-71195118 TTAGCTTTTTGATGTGCTGCTGG + Intronic
933130561 2:78667864-78667886 TTAACTTTTGAATGTGCTGCTGG - Intergenic
933181539 2:79232426-79232448 TTAACCTTTTCATGTGCTTCTGG + Intronic
933237370 2:79880185-79880207 GTAAGTTTTTTATGTGCTGCTGG + Intronic
933268950 2:80212586-80212608 TAAACTTTTTGATGTGCTGCCGG + Intronic
933347687 2:81110337-81110359 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
933435348 2:82242738-82242760 TAAACTTTTTGATGTGCTGCTGG - Intergenic
933619604 2:84522832-84522854 ATTAGTTTTTTATGTGCTTCTGG + Intronic
933642163 2:84775378-84775400 TTAACTTTTTAATATGCTGCTGG + Intronic
934621929 2:95816130-95816152 TTAACTTTTTGATGTGCTGCTGG + Intergenic
934698532 2:96419026-96419048 TGTGCTTTTTGATGTGCTGCTGG + Intergenic
934811518 2:97282667-97282689 TTAACTTTTTGATGTGCTGCTGG - Intergenic
934826173 2:97425273-97425295 TTAACTTTTTGATGTGCTGCTGG + Intergenic
935567605 2:104626087-104626109 TAAACTTTTTGATGTGCTGCTGG + Intergenic
935822964 2:106912936-106912958 TATGCTTTTTGATGTGCTGCTGG - Intergenic
935932335 2:108141226-108141248 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
936036189 2:109114003-109114025 TAAACTTTTTGATGTGCTGCTGG + Intergenic
936390885 2:112072149-112072171 TTAACTTTTTGATGTGCTGCTGG + Intronic
936402850 2:112178625-112178647 TTCGCTTTTTCATGTGCTGCTGG - Intronic
936428889 2:112442664-112442686 ATTACTTTTTGATGTGCTGTTGG - Intergenic
936782524 2:116051313-116051335 TAAGCGTTTTGATGTGCTGCTGG + Intergenic
936899020 2:117462805-117462827 TTTTCTTTTTTATATGCTGTTGG + Intergenic
936995844 2:118413342-118413364 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
937484787 2:122303963-122303985 TTAGCATTTTGATGTGCTGCTGG - Intergenic
937807634 2:126164544-126164566 TACACTTTTTGATGTGCTGCTGG - Intergenic
937848799 2:126613635-126613657 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
937938343 2:127264611-127264633 TTAACTTTTTGATATGCTGCTGG + Intronic
938788652 2:134656962-134656984 TTAACTTCTTGATGTGCTGCTGG + Intronic
938866453 2:135426465-135426487 ATTAGCTTTTGATGTGCTGCTGG - Intronic
939030766 2:137072972-137072994 TGAACTTTTTGATGTGCTGCTGG + Intronic
939083794 2:137693118-137693140 ATTACGTTTCTATTTGCTGTTGG - Intergenic
939223460 2:139335005-139335027 ATTAGGTTTTGATGTGCTGCTGG - Intergenic
939247236 2:139641517-139641539 TTAACTTTTTGATGTGCTGCTGG + Intergenic
939381698 2:141444795-141444817 TATGCTTTTTGATGTGCTGCTGG + Intronic
939653165 2:144789019-144789041 TAAACTTTTTGATGTGCTGCTGG - Intergenic
939912726 2:148003385-148003407 TAAACTTTTTGATGTGCTGCTGG - Intronic
940022923 2:149174750-149174772 TTAGCTTTTTGATGTGCTGCTGG + Intronic
940101079 2:150039169-150039191 TTATCTTTTTGATGTGCTGCTGG - Intergenic
940103622 2:150071832-150071854 TTAACTTTTTCAAGTGCTGCTGG - Intergenic
940125148 2:150314452-150314474 TATGCTTTTTGATGTGCTGCTGG - Intergenic
940437911 2:153676634-153676656 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
940607301 2:155942225-155942247 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
940708236 2:157130396-157130418 TTTGATTTTTGATGTGCTGCTGG - Intergenic
940836346 2:158526257-158526279 TTAGCTTTTTGATGTGCTGCTGG - Intronic
940964859 2:159825731-159825753 TAAACTTTTTGATGTGCTGCTGG - Intronic
941119365 2:161511327-161511349 TTAGCTTTTTGATGTGCTGCTGG - Intronic
941146245 2:161849769-161849791 TTAGCTTTTTGATGTGCTGCTGG + Intronic
941563538 2:167079226-167079248 TTAAGTTTTTGATGTGCTGCTGG + Intronic
941767140 2:169310569-169310591 TAAACTTTTTGATGTGCTGCTGG + Intronic
942405901 2:175654694-175654716 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
942914331 2:181284913-181284935 TTAAATTTTTGATGTGCTGCTGG + Intergenic
942955582 2:181768985-181769007 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
942958388 2:181800921-181800943 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
943030174 2:182676687-182676709 TTAACTTTTTGATGTGCTGCTGG - Intergenic
943057274 2:182997951-182997973 TTAACTTTTTGATGTCCTGCTGG - Intronic
943087117 2:183325710-183325732 TAAACTTTTTGATGTGCTGCTGG - Intergenic
943124506 2:183779855-183779877 ATTACCTTTTGATGTGCTGCTGG - Intergenic
943188829 2:184650082-184650104 TTAACTTTTTGATGTGCTGTTGG - Intronic
943200728 2:184820190-184820212 TAACCTTTTTTATGTGCTGCTGG - Intronic
943257555 2:185615440-185615462 TTAACTTTTTGATGTGTTGCTGG + Intergenic
943306402 2:186267892-186267914 TAAACTTTTTGATGTGCTGCTGG - Intergenic
943453356 2:188073073-188073095 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
943605573 2:189973352-189973374 TAAACTTTTTGATGTGCTGCTGG + Intronic
943616892 2:190102966-190102988 TTAACTTTTTGATGTGCTGCTGG - Intronic
943911181 2:193570008-193570030 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
944802831 2:203253260-203253282 TTTAGGTTCTGTTGTGCTGCTGG + Intronic
945342884 2:208678590-208678612 TTAAGTTTTTGATGTGCTGCTGG + Intronic
945347491 2:208735645-208735667 ATTAACTTTTAATGTGCTGCTGG + Intronic
945361187 2:208897687-208897709 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
945487495 2:210414533-210414555 ATTAGCTTTTGATGTGCTGCTGG + Intergenic
945658574 2:212656315-212656337 ATAACTTTTTTATGTGCTGCTGG + Intergenic
945660185 2:212676198-212676220 TTAACTTTTTTATGTGCTGCTGG + Intergenic
945758590 2:213882198-213882220 TTAATGTTTTGATGTGCTGCTGG + Intronic
945790652 2:214301086-214301108 TTTTCTTTTTGATGTGCTTCTGG - Intronic
946062205 2:216952948-216952970 TTAACTTTTTGATGTGCTGCTGG + Intergenic
946082511 2:217134773-217134795 TATGCTTTTTGATGTGCTGCTGG + Intergenic
946092065 2:217236071-217236093 TTAATTTTTTGATGTGCTGCTGG + Intergenic
946515707 2:220408916-220408938 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
947115176 2:226762338-226762360 TTTGCATTTTTATGTTCTGATGG - Intronic
947146806 2:227075273-227075295 TATGCTTTTTGATGTGCTGCTGG - Intronic
947265710 2:228277714-228277736 TTAACTTTTTGATGTGCTACTGG - Intergenic
947492472 2:230607419-230607441 TAAACTTTTTGATGTGCTGCTGG - Intergenic
947902514 2:233733674-233733696 TAAACTTTTTGATGTGCTGCTGG + Intronic
948078466 2:235185904-235185926 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
948343461 2:237274988-237275010 ATTAGCTTTTTATGTGCTGCTGG - Intergenic
948464691 2:238146698-238146720 TTTATTTTTTTATGGGCTGGGGG - Intronic
948532753 2:238622361-238622383 TTAACTTTTTCATGTGCTGTTGG - Intergenic
1168933154 20:1640977-1640999 TAAACTTTTTGATGTGCTGCGGG + Intronic
1170482685 20:16782674-16782696 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1170486704 20:16824608-16824630 TTAACTTTGTGATGTGCTGCTGG - Intergenic
1170537135 20:17351472-17351494 TTGACTTTTTGATGTGCTGCTGG - Intronic
1170766706 20:19295720-19295742 TAAACTTTTTGATGTGCTGCTGG + Intronic
1171276952 20:23865285-23865307 TTATCTTTTTGATGTGCTGCTGG + Intergenic
1171410745 20:24946546-24946568 GATAAGTTTTGATGTGCTGCTGG - Intergenic
1171466665 20:25333580-25333602 TATGCTTTTTGATGTGCTGCTGG - Intronic
1171791435 20:29529533-29529555 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1171861887 20:30408397-30408419 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172864089 20:38081926-38081948 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1173260797 20:41433298-41433320 TTTATGATTTTATGTGCTTACGG - Intronic
1173294423 20:41743546-41743568 TTAACTTTTTGATGTGCTGTTGG + Intergenic
1173700410 20:45065317-45065339 TTAACCTTTTTATGTGCCGCTGG + Intronic
1174794105 20:53507487-53507509 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1174965263 20:55206510-55206532 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1174989445 20:55493482-55493504 TCTTTGTTTTGATGTGCTGCTGG + Intergenic
1175022856 20:55869484-55869506 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1175513205 20:59548952-59548974 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1176332689 21:5563389-5563411 TGCACTTTTTAATGTGCTGCTGG + Intergenic
1176395068 21:6257562-6257584 TGCACTTTTTAATGTGCTGCTGG - Intergenic
1176442089 21:6731542-6731564 TGCACTTTTTAATGTGCTGCTGG + Intergenic
1176466351 21:7058611-7058633 TGCACTTTTTAATGTGCTGCTGG + Intronic
1176489912 21:7440389-7440411 TGCACTTTTTAATGTGCTGCTGG + Intergenic
1176598445 21:8769812-8769834 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1176699063 21:10021061-10021083 TGAACTTTTTGATGTGCTGCTGG - Intergenic
1177090152 21:16757862-16757884 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1177136766 21:17312680-17312702 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1177294487 21:19157036-19157058 TTACCTTTTTGATGTGCTGCTGG + Intergenic
1177426231 21:20925842-20925864 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1177474316 21:21598800-21598822 TTAATTTTTTGATGTGCTGCTGG - Intergenic
1177567080 21:22837979-22838001 TTAACTTTTTGATATGCTGCCGG - Intergenic
1177662219 21:24099753-24099775 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1177718601 21:24874286-24874308 TTAACTTTTTGATATGCTGCTGG + Intergenic
1177723262 21:24934844-24934866 TTTCTGTTTGTATGTTCTGCTGG - Intergenic
1177914036 21:27065758-27065780 ATTAACTTTTGATGTGCTGCAGG - Intergenic
1177941518 21:27417426-27417448 TTTACTTTTTAATGTGCTAAGGG + Intergenic
1178034176 21:28562747-28562769 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1178212284 21:30549644-30549666 TTAACTTTTTGATGTGCTGTTGG + Intronic
1179256265 21:39718717-39718739 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1179771687 21:43624035-43624057 TGTACCATTTTATGTGCTGGTGG - Intronic
1180218618 21:46343487-46343509 TTATCTTTTTTATGTGCTGTTGG + Intronic
1180724339 22:17934230-17934252 TAAACTTTTTGATGTGCTGCTGG - Intronic
1181794718 22:25297920-25297942 CTTTCTTTTTCATGTGCTGCTGG - Intergenic
1182152629 22:28040360-28040382 TAAGCTTTTTTATGTGCTGCTGG - Intronic
1182157355 22:28087284-28087306 TAAGCGTTTTGATGTGCTGCTGG - Intronic
1182591605 22:31385201-31385223 TTTGCTTTTTGATGTGCTGCTGG + Intergenic
1182817151 22:33175105-33175127 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1185237323 22:49721720-49721742 TTTAAGTTTTTATTTTCAGCTGG + Intergenic
949446080 3:4135246-4135268 TAAACTTTTTGATGTGCTGCTGG - Intronic
949456070 3:4240136-4240158 TAAACTTTTTGATGTGCTGCTGG + Intronic
949601517 3:5603704-5603726 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
950848614 3:16040256-16040278 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
951100926 3:18687396-18687418 TTTATCCTTTTATGTACTGCTGG + Intergenic
951168330 3:19508111-19508133 TGAACTTTTTGATGTGCTGCTGG + Intronic
951197532 3:19840667-19840689 ATTAGCTTTTGATGTGCTGCTGG - Intergenic
951261081 3:20509752-20509774 TTAACTTTTTGACGTGCTGCTGG + Intergenic
951267984 3:20592054-20592076 TTCACCTTTTCATGGGCTGCTGG + Intergenic
951341720 3:21496674-21496696 TTCGCTTTTTGATGTGCTGCTGG - Intronic
951361155 3:21725950-21725972 TAAACTTTTTGATGTGCTGCTGG - Intronic
951518096 3:23584281-23584303 TTTGCTTTTTTGTATGCTGCTGG + Intronic
951653395 3:24978119-24978141 TAAACTTTTTGATGTGCTGCTGG + Intergenic
951740660 3:25919235-25919257 TTAACTTTTTGATGTGCTGCTGG + Intergenic
951758798 3:26121984-26122006 TTTACTTTTTGATGTGCTGCTGG - Intergenic
951828951 3:26902121-26902143 TTAACTTTTTGATGTGCTGGTGG - Intergenic
951957411 3:28272588-28272610 TAAACGTCTTGATGTGCTGCTGG + Intronic
952127757 3:30321885-30321907 TTAACATTTTGATGTGCTGCTGG - Intergenic
952616669 3:35281704-35281726 TACACTTTTTGATGTGCTGCAGG - Intergenic
952642302 3:35612191-35612213 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
952999074 3:38914846-38914868 TTAGCTTTTTAATGTGCTGCTGG + Intronic
953026056 3:39145858-39145880 TTTACCTTTTTATGTACTGTAGG - Intronic
953047578 3:39308326-39308348 TAAACTTTTTGATGTGCTGCTGG - Intergenic
953104571 3:39863922-39863944 TTAGCTTTTTGATGTGCTGCTGG - Intronic
953350565 3:42212369-42212391 TGAACCTTTTTATGTGCAGCTGG + Intronic
953721528 3:45359989-45360011 TTAACTTTTTGATGTGCTGCTGG + Intergenic
954161774 3:48727846-48727868 TTGAAGTTCTTATGTGCTGGAGG + Intronic
954485445 3:50846378-50846400 ATTATCTTTTGATGTGCTGCTGG + Intronic
954503297 3:51042206-51042228 TTCACTTTTTGATGTGCTGCTGG - Intronic
955806523 3:62741396-62741418 TTAGCTTTTTGATGTGCTGCTGG - Intronic
955886415 3:63603712-63603734 TTAGCTTTTTGATGTGCTGCTGG + Intronic
956207063 3:66766027-66766049 TACACGTCTTGATGTGCTGCTGG + Intergenic
956269115 3:67431226-67431248 TAAACTTTTTGATGTGCTGCTGG - Intronic
956300000 3:67761786-67761808 TAAACTTTTTGATGTGCTGCTGG + Intergenic
956372213 3:68575228-68575250 TTATCTTTTTGATGTGCTGCTGG - Intergenic
956375077 3:68605579-68605601 TATACCTTTTCATGTGCTGCTGG - Intergenic
956378597 3:68642365-68642387 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
956397758 3:68843885-68843907 TTAGCTTTTTGATGTGCTGCTGG + Intronic
956536951 3:70287426-70287448 TAAACTTTTTGATGTGCTGCTGG + Intergenic
957466291 3:80597349-80597371 TAAACTTTTTGATGTGCTGCTGG - Intergenic
957537453 3:81525399-81525421 TAAGCGTTTTGATGTGCTGCTGG + Intronic
957711790 3:83870141-83870163 ATTAAGTTTTGAGGTGCTGCTGG + Intergenic
957915151 3:86679046-86679068 TTAAGTTTTTGATGTGCTGCTGG + Intergenic
958015047 3:87930654-87930676 TAAACTTTTTTATGTGCTTCTGG + Intergenic
958064031 3:88519786-88519808 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
958208227 3:90433020-90433042 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
958253274 3:91294889-91294911 TATGCTTTTTGATGTGCTGCTGG - Intergenic
958264121 3:91417848-91417870 TTCGCTTTTTGATGTGCTGCTGG - Intergenic
958460571 3:94389513-94389535 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
958562196 3:95760452-95760474 TTAACGTTTTGATATGCTGCTGG - Intergenic
958615572 3:96489954-96489976 ATTAACTTTTTCTGTGCTGCTGG + Intergenic
958727723 3:97926192-97926214 TTAACTTTTTGATGTCCTGCTGG - Intronic
958811253 3:98862492-98862514 TAAACTTTTTGATGTGCTGCTGG - Intronic
958817853 3:98936420-98936442 TTAACTTTTTGATGTGCTGCTGG - Intergenic
958823296 3:99001471-99001493 TTAACTTTTTGATGTGCTGCTGG + Intergenic
958867046 3:99513173-99513195 TTTATGATTTTATGAGTTGCAGG + Intergenic
959170085 3:102833801-102833823 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
959326929 3:104948696-104948718 TATGCCTTTTGATGTGCTGCTGG + Intergenic
959340890 3:105129240-105129262 TTAACTTTTTCATGTGCTGCTGG + Intergenic
959463263 3:106652420-106652442 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
959519826 3:107312854-107312876 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
959522630 3:107337476-107337498 TAAACTTTTTGATGTGCTGCTGG - Intergenic
959610649 3:108291052-108291074 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
959611242 3:108297252-108297274 TTTAGGTTTTTTTGTGTTACTGG + Intronic
959825274 3:110787180-110787202 TTAACTTTTTGATGTGCTGCTGG + Intergenic
959870149 3:111317770-111317792 TTAGCTTTTTGATGTGCTGCTGG - Intronic
959881752 3:111451447-111451469 TTATCTTTTTGATGTGCTGCTGG - Intronic
959947791 3:112145325-112145347 TTAACTTTCTGATGTGCTGCTGG + Intronic
959961006 3:112297587-112297609 ATTTCTTTTTTATATGCTGCTGG + Intergenic
959998738 3:112707848-112707870 TTAACTTTTTGATGTACTGCTGG + Intergenic
960061019 3:113321144-113321166 TTAACTTTTTGATGTGCTGCTGG - Intronic
960075131 3:113475557-113475579 TAAACTTTTTGATGTGCTGCTGG - Intronic
960118586 3:113923636-113923658 TTAGCTTTTTGATGTGCTGCTGG + Intronic
960462040 3:117947809-117947831 TTAACACTTTGATGTGCTGCTGG + Intergenic
960561513 3:119089202-119089224 TTAACTTTTTGATGTGCTGTAGG - Intronic
960566136 3:119133844-119133866 TAGACTTTTTGATGTGCTGCTGG - Intronic
960644476 3:119863605-119863627 TTTCCCTTTTTTTGTACTGCAGG - Exonic
960685983 3:120294117-120294139 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
960758038 3:121040180-121040202 TTTACGTTTTTGAGTGCTAAAGG + Intronic
960868200 3:122223813-122223835 TTAACTTTTTGATGTGCTGCTGG - Intronic
961334682 3:126165290-126165312 TTAACTTTTTGATGTGCTGCTGG + Intronic
961932754 3:130551030-130551052 TTAGCTTTTTCATGTGCTGCTGG + Intergenic
962183577 3:133234373-133234395 TAAGCGTTTTGATGTGCTGCTGG - Intronic
962239324 3:133738085-133738107 TAAACTTTTTGATGTGCTGCTGG - Intergenic
962333438 3:134502199-134502221 TTATCTTTTTGATGTGCTGCTGG + Intronic
962644651 3:137424577-137424599 TTATCTTTTTTATGTGCTGTTGG - Intergenic
962675509 3:137754470-137754492 TAAATGTTTTTATGTGCTGCTGG - Intergenic
962690042 3:137886563-137886585 TAAACTTTTTGATGTGCTGCTGG - Intergenic
962692283 3:137911054-137911076 TAAATGTTTTTATGTGCTGCTGG - Intergenic
962879978 3:139567709-139567731 TATGCTTTTTGATGTGCTGCTGG + Intronic
963098527 3:141573922-141573944 TTTACCTTTTTAAATCCTGCAGG + Exonic
963381777 3:144539564-144539586 TTTGCTTTTTGTTGTGCTGCTGG - Intergenic
963417411 3:145015738-145015760 TTAACTTTTTGATGTGCTGCTGG - Intergenic
963527891 3:146437144-146437166 TAAACTTTTTGATGTGCTGCTGG + Intronic
963567942 3:146953926-146953948 TTTACTTTTTCCTGTGCTGCAGG - Intergenic
963614960 3:147525046-147525068 TTAACTTTTTGATATGCTGCTGG + Intergenic
963763835 3:149312659-149312681 ATAACTTTTTGATGTGCTGCTGG - Intergenic
963891661 3:150642582-150642604 TTATCTTTTTGATGTGCTGCTGG - Intergenic
963989069 3:151632348-151632370 TTTAGGTTTTTATTTGCAGAAGG + Intergenic
964029300 3:152118062-152118084 TAAGCGTTTTGATGTGCTGCTGG + Intergenic
964161896 3:153655639-153655661 TAAACTTTTTGATGTGCTGCTGG - Intergenic
964162598 3:153663468-153663490 TTAACTTTTTGATGTGCTGATGG + Intergenic
964182641 3:153906789-153906811 TTTACTTTGTTTTGTGATGCTGG + Intergenic
964429686 3:156592008-156592030 TAAACTTTTTGATGTGCTGCTGG + Intergenic
964464035 3:156969895-156969917 TATGCTTTTTGATGTGCTGCTGG - Intronic
964535966 3:157721933-157721955 TTAACTTTTTGATGTGCTGCTGG + Intergenic
964651096 3:159012204-159012226 TTTATGTTTGTTTGTGCAGCGGG + Intronic
964652075 3:159022934-159022956 TTAACTTTTTGATATGCTGCTGG + Intronic
964759365 3:160119649-160119671 ATAAGCTTTTTATGTGCTGCTGG - Intergenic
964816572 3:160723883-160723905 TTAACTTTTTGATGTGCTGCTGG - Intergenic
964846177 3:161046712-161046734 TAAACTTTTTGATGTGCTGCTGG - Intronic
964882328 3:161437338-161437360 TTAACTTTTTGATGTGCTTCTGG - Intergenic
964890279 3:161526518-161526540 TAAACTTTTTGATGTGCTGCTGG + Intergenic
964934660 3:162067839-162067861 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
964991217 3:162814974-162814996 TTAACTTTTTGATGTGCTGCTGG + Intergenic
965022488 3:163251432-163251454 ATAAGGTTTTGATGTGCTGCTGG + Intergenic
965023287 3:163263719-163263741 TTAGCTTTTTGATGTGCTGCAGG + Intergenic
965112502 3:164445913-164445935 ATTAGCTTTTGATGTGCTGCAGG + Intergenic
965159665 3:165116074-165116096 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
965229779 3:166035446-166035468 ATTAATTTTTGATGTGCTGCTGG + Intergenic
965249573 3:166326117-166326139 TTAACGTTTTGATATGCTACTGG + Intergenic
965332352 3:167391353-167391375 TAAACTTTTTGATGTGCTGCTGG + Intergenic
965748178 3:171947315-171947337 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
965849972 3:173011183-173011205 TTAACTTTTTGATGTGCTGCTGG - Intronic
966033838 3:175385410-175385432 TATACATATTTATGTGCTGTCGG + Intronic
966145175 3:176803400-176803422 TTCACTTTTTGATGTGCTGTTGG - Intergenic
966316340 3:178650682-178650704 TATTCTTTTTGATGTGCTGCTGG - Intronic
966453763 3:180092410-180092432 TTAACTTTTTAATGTGCTGCTGG + Intergenic
966536699 3:181043119-181043141 TATGCTTTTTGATGTGCTGCTGG + Intergenic
966574234 3:181481402-181481424 TAAACTTTTTGATGTGCTGCTGG - Intergenic
966780882 3:183583322-183583344 TTTAAGGTTTTATTTTCTGCTGG + Intergenic
967454090 3:189661441-189661463 TTAACTTTTTGATGCGCTGCTGG + Intronic
967646084 3:191926017-191926039 TTAACTTTTTGATGTGCTGCTGG + Intergenic
968212482 3:196860561-196860583 TTAACTTTTTGATGTGCTGCTGG - Intergenic
969165004 4:5300062-5300084 TTAACTTTTTGATGTGCTGCCGG - Intronic
969970679 4:11044638-11044660 TAAACTTTTTGATGTGCTGCTGG + Intergenic
970259506 4:14209466-14209488 TAAACTTTTTGATGTGCTGCTGG + Intergenic
970266180 4:14289057-14289079 TTAACTTTTTGATGTACTGCTGG + Intergenic
970633778 4:17984136-17984158 TTAGCTTTTTGATGTGCTGCTGG + Intronic
970653924 4:18210000-18210022 TTAACTTTTTGATGTGCTGCTGG + Intergenic
970759930 4:19472603-19472625 TTATCTTTTTGATGTGCTGCTGG - Intergenic
970875622 4:20866280-20866302 TTAACTTTTTGATGTGCTGCTGG - Intronic
970995292 4:22260455-22260477 TAAACTTTTTGATGTGCTGCTGG - Intergenic
971044478 4:22790349-22790371 GTAACTTTTTGATGTGCTGCTGG + Intergenic
971429376 4:26548617-26548639 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
971442048 4:26697634-26697656 TAAACTTTTTGATGTGCTGCTGG - Intronic
971511254 4:27427538-27427560 TTTACTCTTTTATGTGTTTCTGG + Intergenic
971561052 4:28079968-28079990 TATGCTTTTTGATGTGCTGCTGG - Intergenic
971601735 4:28600505-28600527 TTTATGTTAATATGTGCTCCTGG - Intergenic
971708227 4:30076401-30076423 TAAACTTTTTGATGTGCTGCTGG + Intergenic
971858140 4:32069850-32069872 TTAACTTTTTGATGTGCTGCTGG + Intergenic
972000050 4:34019884-34019906 CTTACTTTTTGATGTGCTACTGG + Intergenic
972027856 4:34409504-34409526 TTTGCTTTTTGATGTGCTGATGG + Intergenic
972121322 4:35707973-35707995 TTAACTTTTTCATGTGCTGCTGG + Intergenic
972143212 4:35987477-35987499 TTAGCTTTTTCATGTGCTGCTGG - Intronic
972188257 4:36558766-36558788 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
972219657 4:36939385-36939407 TAAACTTTTTGATGTGCTGCTGG - Intergenic
972363698 4:38353011-38353033 TTAACTTTTTGATGTGCTGTTGG - Intergenic
972368827 4:38401525-38401547 TTAACTTTTTAATGTGCTGTTGG + Intergenic
972680471 4:41301751-41301773 TTATCTTTTTGATGTGCTGCTGG + Intergenic
972819643 4:42685075-42685097 TTAGCCTTTTGATGTGCTGCTGG + Intergenic
972834266 4:42850132-42850154 TTCACTTTTTGATGTGCTGCTGG + Intergenic
972994807 4:44867220-44867242 ATTACATTTTGAGGTGCTGCTGG + Intergenic
973001570 4:44958082-44958104 TTAACTTTCTGATGTGCTGCTGG + Intergenic
973011353 4:45078732-45078754 TTAACTTTTTGATGTGCTACTGG + Intergenic
973013541 4:45107484-45107506 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
973131209 4:46651133-46651155 TTAACTTTTTTATGTGCTATTGG - Intergenic
973150358 4:46880141-46880163 TTAACTTTTTGATGTGCTGCTGG + Intronic
973836107 4:54810858-54810880 TAAACTTTTTGATGTGCTGCTGG - Intergenic
973859271 4:55045042-55045064 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
974126532 4:57703385-57703407 TTAACTTTTCTATGTGCTGCTGG + Intergenic
974141772 4:57897103-57897125 TAAACTTTTTGATGTGCTGCTGG + Intergenic
974162101 4:58153290-58153312 TAAACTTTTTAATGTGCTGCTGG - Intergenic
974216239 4:58851300-58851322 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
974217509 4:58869986-58870008 TTAACTCTTTGATGTGCTGCTGG + Intergenic
974222290 4:58991168-58991190 TTAGCTTTTTAATGTGCTGCTGG - Intergenic
974239923 4:59233852-59233874 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
974280282 4:59783070-59783092 TAAACTTTTTGATGTGCTGCTGG - Intergenic
974482669 4:62466631-62466653 TTAACTTTTTGATGTGCTGCTGG + Intergenic
974572717 4:63674832-63674854 TCTAAATTTTTATGAGCTGCTGG + Intergenic
974577188 4:63740664-63740686 TATTCTTTTTGATGTGCTGCTGG + Intergenic
974762148 4:66291065-66291087 TTAACTTTTTGATGTGCTGCTGG - Intergenic
974797549 4:66772409-66772431 TAAACTTTTTGATGTGCTGCTGG + Intergenic
974896026 4:67940102-67940124 TTAACTTTTTGATGTGCTGCTGG + Intronic
974914119 4:68158373-68158395 TTAACTTTTTTATGTGTTGCTGG + Intergenic
975088815 4:70376267-70376289 TATGCTTTTTGATGTGCTGCTGG - Intronic
975105795 4:70567803-70567825 TTCACTTTTTGATATGCTGCTGG + Intergenic
975158629 4:71100225-71100247 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
975199677 4:71572142-71572164 TTTACTTCTTTGGGTGCTGCAGG + Intergenic
975275954 4:72501980-72502002 TTCACTTTTTGATGTGCTGCTGG + Intronic
975344593 4:73279736-73279758 ATTAACTTTTGATGTGCTGCTGG + Intergenic
975403080 4:73959816-73959838 TAAACTTTTTGATGTGCTGCTGG + Intergenic
975786112 4:77890253-77890275 TTAGCTTTTTGATGTGCTGCTGG - Intronic
975842616 4:78491426-78491448 TAAACTTTTTGATGTGCTGCTGG - Intronic
975941860 4:79657514-79657536 TTAACTTTTTGATGTGCTGTTGG - Intergenic
976060986 4:81128199-81128221 TAAACTTTTTTATGTGCTGCTGG + Intronic
976070958 4:81239219-81239241 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
976197272 4:82545169-82545191 TTAACTTTTTGATGTGCTGCTGG - Intronic
976459150 4:85287686-85287708 TTCACTCTTTGATGTGCTGCTGG + Intergenic
976527518 4:86111595-86111617 TAAGCTTTTTTATGTGCTGCTGG + Intronic
976537839 4:86239214-86239236 ATAAGCTTTTTATGTGCTGCTGG + Intronic
976861923 4:89675719-89675741 TATGCTTTTTGATGTGCTGCTGG - Intergenic
976941838 4:90711698-90711720 TAAACGTTTTGATGTCCTGCTGG + Intronic
976973975 4:91143843-91143865 TTAACTGCTTTATGTGCTGCTGG + Intronic
977005641 4:91566258-91566280 TTGGCTTTTTGATGTGCTGCTGG + Intronic
977040604 4:92012659-92012681 TTAACTTTTTGACGTGCTGCTGG - Intergenic
977185309 4:93929275-93929297 ATAACTTTTTAATGTGCTGCTGG + Intergenic
977228531 4:94423894-94423916 TTAACTTTTTGGTGTGCTGCTGG - Intergenic
977303010 4:95289391-95289413 TTCATGTTGTTATCTGCTGCTGG + Intronic
977344011 4:95795136-95795158 TAAACTTTTTGATGTGCTGCTGG - Intergenic
977481001 4:97575394-97575416 TTAACTTTTTGATGTGCTGCTGG - Intronic
977497588 4:97797556-97797578 TAAACTTTTTGATGTGCTGCTGG + Intronic
977626162 4:99191664-99191686 TTACCTTTTTGATGTGCTGCTGG + Intergenic
977649236 4:99450617-99450639 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
977843653 4:101741261-101741283 TAAACTTTTTGATGTGCTGCTGG + Intronic
978004511 4:103599823-103599845 TAAACTTTTTGATGTGCTGCTGG + Intronic
978163588 4:105579599-105579621 TTAGCTTTTTGATGTGCTGCTGG + Intronic
978313606 4:107413021-107413043 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
978692146 4:111526548-111526570 TTAACTTTTTGATGTACTGCTGG + Intergenic
978926808 4:114255892-114255914 TTATCTTTTTCATGTGCTGCTGG - Intergenic
979012176 4:115386360-115386382 ATTAGATTTTTATGTGCTGCTGG + Intergenic
979076587 4:116278421-116278443 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
979095898 4:116550979-116551001 TTAACTTTTTGATGTGCTGCTGG + Intergenic
979103812 4:116658982-116659004 TAAACTTTTTGATGTGCTGCTGG - Intergenic
979143191 4:117204575-117204597 TTAACTTTTTTATTTGCTGCTGG - Intergenic
979176386 4:117669018-117669040 TAAACTTTTTGATGTGCTGCTGG + Intergenic
979190919 4:117857491-117857513 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
979207002 4:118050006-118050028 TTAAATTTTTGATGTGCTGCTGG - Intronic
979321167 4:119326634-119326656 TAAACTTTTTGATGTGCTGCTGG + Intergenic
979373611 4:119918249-119918271 TAAACTTTTTGATGTGCTGCTGG - Intergenic
979504611 4:121481428-121481450 TTAACTTTTTGATGTGCTACTGG + Intergenic
979905181 4:126280543-126280565 GTAAAGTTTTTATGTGCTGGAGG + Intergenic
979930284 4:126621489-126621511 ATTATGTTTTTACGTGCTGCTGG - Intergenic
979962780 4:127040682-127040704 TTAACTTTTTGATGTGCTGCTGG - Intergenic
979978265 4:127223680-127223702 TAAACTTTTTGATGTGCTGCTGG + Intergenic
980088079 4:128412576-128412598 TTAACTTCTTGATGTGCTGCTGG + Intergenic
980090569 4:128438841-128438863 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
980371524 4:131880375-131880397 TGAACTTTTTGATGTGCTGCTGG - Intergenic
980454846 4:133025806-133025828 TTAACTTTTTGATATGCTGCTGG - Intergenic
980531846 4:134066907-134066929 TTAGCTTTTTTATGTGCTGCTGG + Intergenic
980538611 4:134163623-134163645 TTATCTTTTTTATGTGCTGTTGG - Intergenic
980553588 4:134372493-134372515 TTAACTTTTTAATGTGCTGCTGG - Intergenic
980580921 4:134749137-134749159 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
980647399 4:135660163-135660185 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
980687956 4:136254708-136254730 TAAACTTTTTGATGTGCTGCTGG - Intergenic
980747001 4:137031059-137031081 TTTGCTTTTTGATGTGCTGCTGG - Intergenic
980992573 4:139750644-139750666 TTTATATTTTTATCAGCTGCAGG - Intronic
981062926 4:140446035-140446057 TTAGCTTTTTGATGTGCTGCTGG + Intronic
981071953 4:140550698-140550720 TTTTCGTTTTTATGTGTTATAGG + Exonic
981241245 4:142478655-142478677 TTAGCTTTTTGATGTGCTGCTGG + Intronic
981453761 4:144929960-144929982 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
981544583 4:145881014-145881036 TTTACCTTTGTTTGTGCTGCTGG - Intronic
981560616 4:146044634-146044656 TAAACTTTTTGATGTGCTGCTGG + Intergenic
981664952 4:147213718-147213740 TTACCTTTTTGATGTGCTGCTGG + Intergenic
981810041 4:148763512-148763534 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
981987841 4:150879143-150879165 TTAACTTTTTGATGTGTTGCTGG - Intronic
982040657 4:151392751-151392773 TTAACTTTTTCATATGCTGCTGG - Intergenic
982625144 4:157757180-157757202 TAAATGTTTTGATGTGCTGCTGG + Intergenic
982646477 4:158030147-158030169 TAAGCGTTTTGATGTGCTGCTGG - Intergenic
982843110 4:160217807-160217829 TTAACTTTTTGATGTGCTGTTGG + Intergenic
982916027 4:161210492-161210514 TTTATTTTTGTATTTGCTGCTGG + Intergenic
983002611 4:162436467-162436489 TTAACTTTTTGATGGGCTGCTGG + Intergenic
983005485 4:162479327-162479349 TTAACTTTTTAACGTGCTGCTGG + Intergenic
983103529 4:163656679-163656701 ATAAGCTTTTTATGTGCTGCTGG - Intronic
983179122 4:164627021-164627043 TTAACTTTTTGATGTGCGGCTGG - Intergenic
983548035 4:168983682-168983704 TTAGCTTTTTCATGTGCTGCTGG - Intronic
983598989 4:169502506-169502528 TTTTCATTTTAATGTGCTACTGG - Intronic
983629083 4:169831305-169831327 TTCCCTTTTTTAAGTGCTGCTGG - Intergenic
983688116 4:170435059-170435081 TAAACTTTTTGATGTGCTGCTGG - Intergenic
983819984 4:172181241-172181263 TATACTTTTTGATGTGCTGCTGG - Intronic
983824333 4:172238969-172238991 TTAGCATTTTGATGTGCTGCTGG + Intronic
983948491 4:173612767-173612789 TAAACTTTTTGATGTGCTGCTGG + Intergenic
983951241 4:173644445-173644467 TTTACATTTTTATATGTAGCTGG + Intergenic
984038240 4:174695362-174695384 ATTAGCTTTTGATGTGCTGCTGG - Intronic
984144138 4:176040653-176040675 TATGCTTTTTGATGTGCTGCTGG + Intergenic
984236239 4:177162060-177162082 TTAGCTTTTTTATGTGCAGCTGG - Intergenic
984384144 4:179033689-179033711 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
984465749 4:180099028-180099050 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
984708109 4:182862631-182862653 TTTGCCATTTTATCTGCTGCAGG - Intergenic
985186398 4:187321127-187321149 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
985204874 4:187524528-187524550 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1202753130 4_GL000008v2_random:28090-28112 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
985831293 5:2233970-2233992 TTAGTGTTTTGATGTGCTGCTGG + Intergenic
986149740 5:5116677-5116699 TTAACTTTTTGATGTGCTCCAGG + Intergenic
986620724 5:9670914-9670936 TTAGCTTTTTGATGTGCTGCTGG - Intronic
986675533 5:10181399-10181421 TAAACTTTTTAATGTGCTGCTGG - Intergenic
986753883 5:10815727-10815749 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
986883487 5:12205173-12205195 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
986896800 5:12381089-12381111 TATGCTTTTTGATGTGCTGCTGG + Intergenic
986945051 5:13007481-13007503 TTGACTTTTTGATGTACTGCTGG - Intergenic
986975219 5:13386287-13386309 TTGACTTTTTGATGTGCTGCTGG - Intergenic
987209361 5:15663689-15663711 TTAGCTTTTTTATGTGCTGCTGG + Intronic
987430217 5:17823853-17823875 TTAGCTTTTTTATGTGCTGCTGG - Intergenic
987648969 5:20715760-20715782 TTAATTTTTTGATGTGCTGCTGG + Intergenic
987656873 5:20818376-20818398 TCTCCTTTTTAATGTGCTGCTGG - Intergenic
987861030 5:23488429-23488451 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
987889327 5:23855729-23855751 TACACTTTTTGATGTGCTGCTGG + Intergenic
987974452 5:24994759-24994781 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
988063857 5:26209076-26209098 TTTACTTTTTGATGTGCTGCTGG - Intergenic
988104944 5:26732646-26732668 TTAAATTTTTAATGTGCTGCTGG + Intergenic
988110806 5:26816532-26816554 TGAACTTTTTGATGTGCTGCTGG - Intergenic
988161847 5:27528351-27528373 TTAACTTTTTGATATGCTGCTGG + Intergenic
988186168 5:27865665-27865687 TTAACTTTTTAATATGCTGCAGG - Intergenic
988238660 5:28579138-28579160 TTAACTTTTTGATGTGCTGCTGG - Intergenic
988369010 5:30342986-30343008 TTATCTTTTTGATGTGCTGCTGG + Intergenic
988746599 5:34145777-34145799 TTAATTTTTTGATGTGCTGCTGG - Intergenic
988766680 5:34385574-34385596 TCTCCTTTTTAATGTGCTGCTGG + Intergenic
988935316 5:36076374-36076396 TTATCTTTTTGATGTGCTGCTGG + Intergenic
988979844 5:36556242-36556264 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
989029283 5:37101468-37101490 TAAACTTTTTGATGTGCTGCTGG + Intergenic
989216700 5:38911685-38911707 TTAGCTTTTTAATGTGCTGCTGG - Intronic
989231249 5:39088990-39089012 ATTATTTTTTTATGTGCTGTTGG - Intergenic
989320368 5:40127435-40127457 TAAACTTTTTAATGTGCTGCTGG + Intergenic
989651363 5:43694648-43694670 TTAGCTTTTTGATGTGCTGCTGG + Intronic
989692963 5:44167434-44167456 TTCACTGTTTTATGTGCTGCTGG + Intergenic
989793256 5:45433234-45433256 TTTGCTTTTTGATGTGCTGCTGG + Intronic
989845416 5:46134630-46134652 TATGCTTTTTGATGTGCTGCTGG - Intergenic
989953892 5:50333844-50333866 TATGCTTTTTGATGTGCTGCTGG - Intergenic
990089559 5:52025042-52025064 TTAGCTTTTTCATGTGCTGCTGG - Intronic
990134278 5:52626530-52626552 TTAGCATTTTGATGTGCTGCCGG + Intergenic
990167810 5:53014467-53014489 TTAGCTTTTTGATGTGCTGCTGG + Intronic
990390639 5:55316406-55316428 TTAGCTTTTTGATGTGCTGCTGG - Intronic
990534759 5:56709711-56709733 TTAACTTTTTGATGTGCTGCTGG - Intergenic
990602853 5:57378650-57378672 TAAGCGTTTTGATGTGCTGCTGG + Intergenic
990843269 5:60107631-60107653 TAAACTTTTTGATGTGCTGCTGG - Intronic
990870308 5:60424305-60424327 TAAACTTTTTGATGTGCTGCTGG - Intronic
990898043 5:60720338-60720360 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
991227432 5:64289259-64289281 TTAGCTTTTTGATGTGCTGCTGG + Intronic
991281572 5:64920340-64920362 TTAACTTTTTGATGTGCTGCTGG + Intronic
991324060 5:65409770-65409792 TAAACTTTTTGATGTGCTGCTGG - Intronic
991651249 5:68856581-68856603 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
992336983 5:75781609-75781631 TAAACTTTTTGATGTGCTGCTGG - Intergenic
992507200 5:77398627-77398649 TTTACTTTTGTGTCTGCTGCTGG + Intronic
992965913 5:82000089-82000111 TTAGCTTTTTGATGTGCTGCTGG - Intronic
992976091 5:82121830-82121852 TTAACTTTTTGATGTGCTGTTGG + Intronic
993009356 5:82462277-82462299 TTAACTTTTTGATGTGCTGTTGG - Intergenic
993154584 5:84206669-84206691 TAAACTTTTTGATGTGCTGCTGG - Intronic
993208429 5:84917314-84917336 TTAACTTTTTGATGTGCAGCTGG - Intergenic
993217651 5:85046852-85046874 TTAACCTTTTGACGTGCTGCAGG + Intergenic
993253689 5:85559807-85559829 ATAAGTTTTTTATGTGCTGCTGG - Intergenic
993281080 5:85925069-85925091 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
993286076 5:85998999-85999021 TTAACTTTTTGATGTTCTGCTGG - Intergenic
993362434 5:86994447-86994469 TTAACTTTTTGATGAGCTGCTGG + Intergenic
993451518 5:88076640-88076662 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
993609365 5:90035275-90035297 TAAACTTTTTAATGTGCTGCTGG - Intergenic
993634029 5:90322570-90322592 TTAACTTTTTGATGTGCTGCTGG + Intergenic
993793327 5:92234515-92234537 TTAACTTTTTGATGTGCTGCTGG + Intergenic
993867927 5:93216782-93216804 TAAACTTTTTGATGTGCTGCTGG - Intergenic
993923703 5:93839402-93839424 TTAGCTTTTTGATGTGCTGCTGG + Intronic
993933828 5:93976013-93976035 TTAACTTTTTGATGTGCTGCTGG - Intronic
994233063 5:97331340-97331362 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
994264856 5:97702647-97702669 TAAACTTTTTGATGTGCTGCTGG + Intergenic
994468917 5:100177276-100177298 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
994558298 5:101332410-101332432 TTAGCTTTTTAATGTGCTGCTGG - Intergenic
994597990 5:101863714-101863736 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
994629139 5:102260963-102260985 TTTACATTGTTATTTGCAGCAGG - Intronic
994654291 5:102570529-102570551 TTTACATTTTTATTTGTTTCAGG - Intergenic
994696280 5:103076452-103076474 ATAACCTTTTGATGTGCTGCTGG + Intergenic
994707906 5:103228362-103228384 TTAACTTTTTGATATGCTGCTGG - Intergenic
994897586 5:105725406-105725428 TTAGCTTTTTCATGTGCTGCTGG - Intergenic
995218697 5:109623977-109623999 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
995255572 5:110042425-110042447 TAAACTTTTTGATGTGCTGCTGG + Intergenic
995289441 5:110433847-110433869 TTAACATTTTGATGTGCTGCGGG + Intronic
995428917 5:112053165-112053187 TTCACTTTTTGATGTGCTGCTGG - Intergenic
995507771 5:112878498-112878520 TTTAAGTTTATATTTCCTGCAGG + Exonic
995653574 5:114399466-114399488 TTAGCTTTTTGATGTGCTGCTGG + Intronic
995674471 5:114647629-114647651 TTAACATTTTGATCTGCTGCTGG - Intergenic
995720034 5:115121017-115121039 TAGGCTTTTTTATGTGCTGCTGG - Intergenic
996076533 5:119201435-119201457 TTAGCTTTTTGATGTGCTGCTGG + Intronic
996150360 5:120027307-120027329 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
996264980 5:121528817-121528839 TTAACTTTTAGATGTGCTGCTGG + Intergenic
996323739 5:122249149-122249171 TAAACTTTTTGATGTGCTGCTGG + Intergenic
996427564 5:123331726-123331748 TAAACTTTTTGATGTGCTGCTGG + Intergenic
996456183 5:123685162-123685184 TTAACTTTTTGATGTGCTGTTGG - Intergenic
996481888 5:123984992-123985014 TACACCTTTTGATGTGCTGCTGG + Intergenic
996492966 5:124120308-124120330 TTAACTTTTTGATGTGCTGCTGG + Intergenic
996784165 5:127220333-127220355 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
996804918 5:127443821-127443843 TTTACCTGTTCATGTGCTGATGG + Intronic
996888355 5:128386807-128386829 TTAGCTTTTTGATGTGCTGCTGG + Intronic
997010322 5:129869282-129869304 TTCGTGTTTTGATGTGCTGCTGG - Intergenic
997620221 5:135284305-135284327 TTAACTTTTTGATGTGCTGCTGG + Intronic
997784001 5:136689685-136689707 TTAACTTTTTGATGTGCTGCTGG - Intergenic
998277859 5:140775784-140775806 TAAACTTTTTGATGTGCTGCTGG + Intergenic
998574846 5:143303706-143303728 TTAACTTTTTGATGTGCAGCTGG - Intronic
998776244 5:145606633-145606655 TTAAGTTTTTGATGTGCTGCTGG + Intronic
998873010 5:146571396-146571418 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
999066372 5:148690712-148690734 GTCACATTTTTATGTGCTGTTGG - Intergenic
999352370 5:150886270-150886292 ATTGCTTTTTGATGTGCTGCTGG + Intronic
999834741 5:155357174-155357196 TTAGCTTTTTCATGTGCTGCAGG - Intergenic
999851902 5:155549711-155549733 TTGACTTTTTGATGTGCTGCTGG + Intergenic
999951206 5:156652963-156652985 TTAACTTTTTGATGTGCTGTGGG + Intronic
1000466921 5:161590750-161590772 TTAACTTTTTGAAGTGCTGCTGG + Intronic
1000698354 5:164417803-164417825 TTAGCTTTTTCATGTGCTGCTGG + Intergenic
1000745289 5:165025440-165025462 TTAACTTTTTGATATGCTGCTGG - Intergenic
1001361011 5:171086332-171086354 TAAGCGTTTTGATGTGCTGCTGG + Intronic
1001851122 5:174966805-174966827 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1001886602 5:175296867-175296889 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1002117093 5:176971130-176971152 TGCACTTTTTTATGTGCTGGAGG - Intronic
1002369194 5:178737134-178737156 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1002380031 5:178820483-178820505 TTAACATTTTCATGTGCTGCTGG + Intergenic
1003438407 6:6116556-6116578 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1003724160 6:8740509-8740531 TTAACTTTTTTATGTGCTGCTGG - Intergenic
1004092969 6:12524232-12524254 TTCGCTTTTTGATGTGCTGCTGG + Intergenic
1004593612 6:17077529-17077551 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1004809351 6:19242453-19242475 TGAACTTTTTGATGTGCTGCTGG - Intergenic
1004910923 6:20282808-20282830 TTAACTTTCTGATGTGCTGCTGG - Intergenic
1005277482 6:24235420-24235442 TTAACCTTTTGATGTGCTGCTGG - Intronic
1005544743 6:26854016-26854038 TTAATTTTTTGATGTGCTGCTGG - Intergenic
1005782071 6:29202519-29202541 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1005793861 6:29336024-29336046 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1005924795 6:30434047-30434069 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1006264538 6:32908174-32908196 TTTACTTTTTTATGCACTGATGG - Intergenic
1007024707 6:38558753-38558775 TTAACTTTTTGATGTGCTGCTGG + Intronic
1007206450 6:40156025-40156047 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1007216074 6:40239330-40239352 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1007314520 6:40975624-40975646 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1007354262 6:41300040-41300062 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1007874623 6:45082420-45082442 TTAACTTTTTGATGTGCTGCTGG - Intronic
1007954817 6:45907393-45907415 TTAACTATTTGATGTGCTGCTGG + Intronic
1007955064 6:45910727-45910749 TTTACTATTTTTTGTGATGCTGG + Intronic
1008080507 6:47189751-47189773 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1008122908 6:47637997-47638019 TAAACTTTTTTATGTGCTGCAGG + Intergenic
1008219633 6:48839861-48839883 TTTGCTTTCTGATGTGCTGCTGG + Intergenic
1008315447 6:50033954-50033976 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1008334466 6:50284856-50284878 TTCGCCTTTTCATGTGCTGCTGG - Intergenic
1008991310 6:57605139-57605161 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1009015533 6:57895649-57895671 TTAATTTTTTGATGTGCTGCTGG - Intergenic
1009033136 6:58084455-58084477 ATTTGTTTTTTATGTGCTGCTGG - Intergenic
1009034650 6:58101912-58101934 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1009179836 6:60503368-60503390 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1009208745 6:60836227-60836249 ATTTGTTTTTTATGTGCTGCTGG - Intergenic
1009210123 6:60852409-60852431 TTAACTTTTGGATGTGCTGCTGG - Intergenic
1009330740 6:62416922-62416944 TACACTTTTTGATGTGCTGCTGG - Intergenic
1009399205 6:63234149-63234171 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1009740546 6:67738074-67738096 TTAAATTTTTCATGTGCTGCTGG - Intergenic
1009759206 6:67981349-67981371 TTTAAGTTGTTAGGTGATGCAGG - Intergenic
1009984617 6:70768118-70768140 TTAAGTTTTTGATGTGCTGCTGG + Intronic
1010000876 6:70947854-70947876 GTAAGGTTTTGATGTGCTGCTGG - Intronic
1010019898 6:71147061-71147083 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1010178214 6:73054466-73054488 TTAGCTTTTTCATGTGCTGCTGG - Intronic
1010275141 6:73960289-73960311 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1010281101 6:74024130-74024152 ATTAACTTTTTATGTGCTGCTGG + Intergenic
1010306379 6:74327730-74327752 ACTACGTTTTTATATGCTGACGG + Intergenic
1010691795 6:78919947-78919969 TTAACTTTTTGATGTGCTGCTGG - Intronic
1010718122 6:79253667-79253689 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1010722158 6:79295636-79295658 TTAACTTTTTGATTTGCTGCTGG + Intergenic
1010763076 6:79746929-79746951 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1010906572 6:81498849-81498871 TTAACTTTTTGATGTGCTGCTGG + Intronic
1010956747 6:82098873-82098895 TATACTTTTTGATGTGCTGTGGG - Intergenic
1010959249 6:82126552-82126574 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1011005113 6:82635816-82635838 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1011062321 6:83284518-83284540 ATTAACTTTTTATGTGCTGCTGG - Intronic
1011063353 6:83296292-83296314 GTAACTTTTTGATGTGCTGCTGG - Intronic
1011065844 6:83324989-83325011 GATAAGTTTTGATGTGCTGCTGG - Intronic
1011103074 6:83745778-83745800 GTTATCTTTTTATATGCTGCTGG - Intergenic
1011360875 6:86523252-86523274 TTAATTTTTTGATGTGCTGCTGG + Intergenic
1011401072 6:86962211-86962233 TTTTCTTCTTTATGTGCTCCAGG - Intronic
1011716770 6:90114289-90114311 TTCATTTTTTGATGTGCTGCTGG - Intronic
1011862323 6:91774847-91774869 TTAACTTTTAGATGTGCTGCTGG - Intergenic
1012075360 6:94675983-94676005 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1012081315 6:94761529-94761551 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1012086126 6:94827919-94827941 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1012222111 6:96661430-96661452 CTAACTTTTTGATGTGCTGCTGG - Intergenic
1012253364 6:97004842-97004864 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1012656471 6:101829035-101829057 CTAATGTTTTCATGTGCTGCTGG - Intronic
1012702454 6:102477712-102477734 TTAACTTTTTCATGTGCTGCTGG - Intergenic
1012810201 6:103947566-103947588 TTAGCTTTTTCATGTGCTGCTGG + Intergenic
1012811934 6:103969852-103969874 TTAACTTTGTGATGTGCTGCTGG - Intergenic
1012878763 6:104760321-104760343 ATAAGCTTTTTATGTGCTGCTGG - Intronic
1013052570 6:106550613-106550635 TTTACATATTTATGTGATGTTGG + Intronic
1013387728 6:109648864-109648886 TAAACTTTTTGATGTGCTGCTGG - Intronic
1013669593 6:112385407-112385429 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1013727458 6:113116844-113116866 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1013848351 6:114482554-114482576 TTAACTTTTTAATGTGCTGCTGG - Intergenic
1013880848 6:114898526-114898548 TTTTTTTTTTTATGTGCTGCTGG - Intergenic
1013926345 6:115477405-115477427 TACACTTTTTGATGTGCTGCTGG + Intergenic
1013933580 6:115566323-115566345 TTAACTTTTTTATGTGCTGCTGG - Intergenic
1014179378 6:118367992-118368014 TTAGCTTTTTCATGTGCTGCTGG - Intergenic
1014330492 6:120057890-120057912 TTTACTTTTTGATGTGCTGCTGG - Intergenic
1014344501 6:120250993-120251015 ATAAGCTTTTTATGTGCTGCTGG - Intergenic
1014485860 6:121998326-121998348 ATAAGCTTTTTATGTGCTGCTGG + Intergenic
1014487706 6:122020819-122020841 TCTACGTTGTCATGTGCTGTGGG - Intergenic
1014560291 6:122881667-122881689 TAAACTTTTTAATGTGCTGCTGG + Intergenic
1014589567 6:123246875-123246897 TAAACTTTTTGATGTGCTGCTGG - Intronic
1014643917 6:123950157-123950179 TTATCGTTTTAATGTGCTGTTGG + Intronic
1014852453 6:126358575-126358597 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1014860073 6:126455331-126455353 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1014954315 6:127596910-127596932 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1015133359 6:129839201-129839223 TAAACTTTTTTATGTGCTGCTGG - Intronic
1015162725 6:130171307-130171329 TAAACTTTTTGATGTGCTGCTGG + Intronic
1015658069 6:135542118-135542140 TTAACCTTTTCAGGTGCTGCTGG - Intergenic
1015698357 6:136007277-136007299 TTAGCCTTTTGATGTGCTGCTGG + Intronic
1015906753 6:138125059-138125081 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1015967380 6:138708283-138708305 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1016108363 6:140190071-140190093 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1016265799 6:142231741-142231763 ATAACGTTTTGATGTGCTGCTGG - Intergenic
1016498803 6:144694255-144694277 TTAGCTTTTTCATGTGCTGCTGG + Intronic
1016572143 6:145526161-145526183 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1016663436 6:146607759-146607781 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1016665741 6:146638010-146638032 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1016665953 6:146640534-146640556 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1016778107 6:147928034-147928056 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1017121762 6:151030648-151030670 TTCAGGTGTTGATGTGCTGCAGG - Intronic
1017580864 6:155863799-155863821 TTAACTTTTTGATGTGCTGTGGG - Intergenic
1017615000 6:156237115-156237137 TTAGCTTTTTCATGTGCTGCTGG + Intergenic
1017676127 6:156815870-156815892 TTTACATTTTTATGTCATCCTGG + Intronic
1018132332 6:160744027-160744049 TTGGCTTTTTTATGTGCTGCTGG + Intronic
1018356670 6:163024848-163024870 TTAACTTTTTGATGTGCCGCTGG - Intronic
1018570072 6:165200401-165200423 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1019581420 7:1765414-1765436 TTTACGTTGCTATGTGCGGTGGG + Intergenic
1020425900 7:8065766-8065788 TTCACTTTTTGATCTGCTGCTGG + Intronic
1020428971 7:8099897-8099919 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1020546307 7:9536304-9536326 TTAACTTTTTGATGTGCTGATGG + Intergenic
1020702658 7:11502409-11502431 TTTAGTTTTTGACGTGCTGCTGG - Intronic
1020773814 7:12428708-12428730 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1020810318 7:12843308-12843330 TGGATGTTTTGATGTGCTGCTGG - Intergenic
1021182752 7:17527397-17527419 TTTTAGTTATTTTGTGCTGCTGG + Intergenic
1021425952 7:20499610-20499632 TTAGCTTTTTTATGTGCTGCTGG - Intergenic
1021769933 7:23989061-23989083 TTCTCTTTTTTATGTGCTGTTGG - Intergenic
1021824415 7:24533988-24534010 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1022545376 7:31182948-31182970 TTTGCTTTTTGATGTGCTGCTGG + Intergenic
1022590228 7:31654479-31654501 TTTACGTTTTGAAGTCATGCTGG + Intronic
1022745047 7:33163197-33163219 TAAACTTTTTGATGTGCTGCTGG + Intronic
1022861438 7:34371080-34371102 CTTACGTCTTCATGTGCTCCAGG - Intergenic
1023075616 7:36479380-36479402 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1024332092 7:48165476-48165498 TTAACTTTTTGCTGTGCTGCTGG - Intergenic
1024405321 7:48972626-48972648 ACTACCTTTTGATGTGCTGCTGG - Intergenic
1024452769 7:49566829-49566851 TTACCTTTTTGATGTGCTGCTGG - Intergenic
1024461565 7:49665056-49665078 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1024651979 7:51411229-51411251 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1025001464 7:55318893-55318915 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1025037155 7:55601839-55601861 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1025779534 7:64587756-64587778 TTGGCTTTTTGATGTGCTGCGGG + Intergenic
1026429618 7:70331593-70331615 ATAAGCTTTTTATGTGCTGCTGG - Intronic
1027370464 7:77504485-77504507 TTTGTGTTTTTATTTGCTACAGG - Intergenic
1027496286 7:78891501-78891523 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1027602132 7:80252325-80252347 CTTACTTTTTTATGTGCTGATGG - Intergenic
1027688517 7:81310058-81310080 TTAACTTTTTGATGTGCTGTTGG - Intergenic
1027860411 7:83571346-83571368 TTAACTTTTTGATGTGCTGCTGG - Intronic
1028304910 7:89250714-89250736 TTAACATTTTGATGTGCTGCTGG - Intronic
1028329240 7:89568113-89568135 TTAACTTTTTGATGTGCTGTGGG - Intergenic
1028346956 7:89794985-89795007 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1028370875 7:90090806-90090828 TTAACTTTTGTATGTGCTGCTGG - Intergenic
1028640183 7:93033543-93033565 TTATCTTTTTGATGTGCTGCTGG - Intergenic
1028785666 7:94790349-94790371 TTAGCTTTTTAATGTGCTGCTGG + Intergenic
1028868748 7:95742248-95742270 TTAACTTTTCGATGTGCTGCTGG - Intergenic
1028991639 7:97054866-97054888 TTAGCTTTTTAATGTGCTGCTGG - Intergenic
1029052788 7:97706901-97706923 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1029334076 7:99885675-99885697 TTACCTTTTTGATGTGCTGCTGG - Intronic
1029939259 7:104462606-104462628 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1030200614 7:106899730-106899752 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1030242226 7:107340654-107340676 TTAACTTTTTGATGTGCTGTTGG - Intronic
1030398208 7:109014819-109014841 TTAACTTTTTGATGTGCTGTTGG - Intergenic
1030413459 7:109211818-109211840 TATTCTTTTTGATGTGCTGCTGG + Intergenic
1030454566 7:109757179-109757201 TTCACTTTTTGATGTGCTGCTGG + Intergenic
1030489882 7:110218801-110218823 TTAACTTTTTGATGTGTTGCTGG + Intergenic
1030614177 7:111720789-111720811 TTCACATTTTGATGTACTGCTGG - Intergenic
1030721170 7:112872252-112872274 TTAACTTTCTGATGTGCTGCTGG - Intronic
1031189434 7:118528485-118528507 TATGCTTTTTGATGTGCTGCTGG - Intergenic
1031239085 7:119215515-119215537 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1031242495 7:119264909-119264931 TTAACTTTTTGTTGTGCTGCTGG + Intergenic
1031248404 7:119348040-119348062 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1031270793 7:119646454-119646476 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1031280036 7:119787632-119787654 TATTCCTTTTGATGTGCTGCTGG - Intergenic
1031391735 7:121223325-121223347 TAAACTTTTTGATGTGCTGCTGG + Intronic
1031547160 7:123064869-123064891 TTAGCTTTTTGATGTGCTGCAGG + Intergenic
1031724287 7:125217859-125217881 ATTATGTTTTGATGTGCTGTTGG - Intergenic
1031736278 7:125366116-125366138 TTAACTTTTTGATTTGCTGCTGG + Intergenic
1031834267 7:126663415-126663437 TTAACTTTTTGATGTGCTGCTGG - Intronic
1032536055 7:132665314-132665336 TAAACTTTTTGATGTGCTGCTGG - Intronic
1032635295 7:133700695-133700717 TTTATGTTTTTATTAGCTGAAGG + Intronic
1032775290 7:135106581-135106603 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1032778450 7:135140924-135140946 TTAGCTTTTTGATGTGCTGCCGG + Intronic
1032912850 7:136453649-136453671 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1032920273 7:136537644-136537666 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1032922150 7:136561251-136561273 TACACTTTTTGATGTGCTGCTGG + Intergenic
1033022875 7:137744666-137744688 TTCACTTTTTGATATGCTGCTGG - Intronic
1033522845 7:142179730-142179752 TTAACTTTTTGATGTGCTCCTGG + Intronic
1033624168 7:143092036-143092058 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1033957490 7:146869389-146869411 TTCGCTTTTTGATGTGCTGCTGG + Intronic
1033984666 7:147209952-147209974 TTAACTTTTTGATGTGCTGCTGG + Intronic
1034216517 7:149411201-149411223 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1034236608 7:149576173-149576195 TAAGCGTTTTGATGTGCTGCTGG + Intergenic
1035141960 7:156771858-156771880 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1035964725 8:4178203-4178225 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1037155292 8:15692190-15692212 TTAACTTTTTGATGTACTGCTGG + Intronic
1038872523 8:31510800-31510822 TGAACTTTTTGATGTGCTGCTGG + Intergenic
1039268264 8:35852396-35852418 TTAACTTTTTGATGTACTGCTGG + Intergenic
1039285154 8:36031822-36031844 TAAACTTTTTAATGTGCTGCTGG - Intergenic
1039383576 8:37109576-37109598 TTTGCTTTTTGATGTGCTGCTGG - Intergenic
1039577712 8:38637515-38637537 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1040405441 8:47097333-47097355 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1040615653 8:49035255-49035277 TTCACTTTTTGATGTGCTGCTGG - Intergenic
1040653353 8:49475545-49475567 TTACCTTTTTGATGTGCTGCTGG - Intergenic
1040771981 8:50988853-50988875 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1040773742 8:51013215-51013237 TTAACTTTTTGATGTGCTGTTGG + Intergenic
1041470824 8:58206983-58207005 TTAACTTTTTAATGTGCTACTGG + Intergenic
1041560386 8:59211220-59211242 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1041615651 8:59903270-59903292 ATAAACTTTTTATGTGCTGCTGG - Intergenic
1041715859 8:60931358-60931380 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1041859350 8:62494389-62494411 TTATCTTTTTGATGTGCTGCTGG + Intronic
1041885634 8:62804423-62804445 TAAACTTTTTGATGTGCTGCTGG - Intronic
1041946217 8:63445871-63445893 TATACTTTTTGATGTGCTGCTGG + Intergenic
1041972264 8:63757430-63757452 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1042110040 8:65371483-65371505 TTAACTTTTTCATGTGCTGCTGG - Intergenic
1042111285 8:65383718-65383740 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1042320052 8:67465822-67465844 TTAACTTTTTAATGTGCTGCTGG + Intronic
1042541456 8:69911304-69911326 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1042629381 8:70800229-70800251 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1042631068 8:70816745-70816767 CTAACTTTTTGATGTGCTGCCGG - Intergenic
1042644955 8:70976585-70976607 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1042703895 8:71646540-71646562 ATTAACTTTTTACGTGCTGCTGG + Intergenic
1042853181 8:73237220-73237242 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1043001335 8:74763738-74763760 TTAACTTTTTGATGTGCTGCTGG - Intronic
1043675038 8:82940590-82940612 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1043726635 8:83619665-83619687 TATGCCTTTTGATGTGCTGCTGG + Intergenic
1043761321 8:84072147-84072169 TTAACTTTTTAATGTGTTGCTGG + Intergenic
1044033652 8:87270031-87270053 TTAACTTTTATATGTGCTGCTGG - Intronic
1044074102 8:87796993-87797015 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1044113635 8:88306552-88306574 TATGCTTTTTTATATGCTGCTGG - Intronic
1044116885 8:88346595-88346617 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1044127657 8:88477969-88477991 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1044159951 8:88900686-88900708 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1044768301 8:95601149-95601171 GTAACTTTTTGATGTGCTGCTGG - Intergenic
1044939908 8:97331505-97331527 TAAACTTTTTAATGTGCTGCTGG + Intergenic
1044960437 8:97525391-97525413 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1045086289 8:98689817-98689839 TTAATTTTTTGATGTGCTGCTGG - Intronic
1045095662 8:98795149-98795171 TTAAGTTTTTGATGTGCTGCTGG - Intronic
1045164582 8:99589166-99589188 TAAACTTTTTGATGTGCTGCTGG + Intronic
1045304284 8:100944376-100944398 TCTACGTTTTTATTTGCTCAGGG - Intronic
1045410936 8:101918105-101918127 TTAACTTTTTGATGTGCTGTTGG - Intronic
1045595207 8:103647199-103647221 TATGCTTTTTTATGTGCTGCTGG + Intronic
1045611980 8:103854732-103854754 TTAACTTTTTGATGTGCTGTTGG + Intronic
1045698976 8:104844078-104844100 TTAACTTTTTGATGTGCTGCTGG + Intronic
1045819734 8:106322171-106322193 TTAACTTTTTGATGTGCTGCTGG - Intronic
1045882887 8:107062051-107062073 TACACTTTTTGATGTGCTGCTGG + Intergenic
1045978155 8:108152828-108152850 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1046140596 8:110085061-110085083 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1046216086 8:111149219-111149241 TTGACTTTTTGATGTGTTGCTGG + Intergenic
1046318167 8:112534803-112534825 TAAACTTTTTGATGTGCTGCTGG - Intronic
1046318694 8:112541906-112541928 TTAACATTTTAATGTGCTGTTGG - Intronic
1046409149 8:113816482-113816504 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1046450025 8:114376851-114376873 TTAACTTTTTGATGTGCTTCTGG - Intergenic
1046596642 8:116269238-116269260 TTATCTTTTTTATGTGCTACTGG + Intergenic
1046708678 8:117485329-117485351 TTAACTTTTTAATGTGCTGCTGG + Intergenic
1046977944 8:120303604-120303626 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1047031554 8:120887215-120887237 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1047119793 8:121888703-121888725 TTAACTTTTGGATGTGCTGCTGG + Intergenic
1047147266 8:122217014-122217036 TTGCCTTTTTGATGTGCTGCTGG - Intergenic
1047342114 8:123992067-123992089 TTTTCTTTTTGATGTGCTGTTGG + Intronic
1047440861 8:124877168-124877190 TTAACTTTTTGATGTGTTGCTGG + Intergenic
1048424435 8:134309879-134309901 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1048636519 8:136301599-136301621 TTAACGTTCTTAGGTGCTGTCGG - Intergenic
1048679174 8:136820149-136820171 ATTAATTTTTGATGTGCTGCTGG + Intergenic
1048701437 8:137094908-137094930 TTAACCTTTCGATGTGCTGCTGG - Intergenic
1049136370 8:140904365-140904387 TATGCTTTTTCATGTGCTGCTGG + Intronic
1049914241 9:301114-301136 TTAACTTTTCAATGTGCTGCTGG - Intronic
1050040018 9:1480185-1480207 TTTTCTTTTTGATGTGCTGTTGG + Intergenic
1050113156 9:2237389-2237411 TGTATGTGTTTATGTGCTGTAGG - Intergenic
1050127366 9:2372389-2372411 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1050390876 9:5143061-5143083 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1050481705 9:6094764-6094786 TTAACTTTTTGATGTGCTGTTGG + Intergenic
1050618801 9:7431009-7431031 TTAACTATTTGATGTGCTGCTGG + Intergenic
1050688736 9:8201342-8201364 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1050840148 9:10138674-10138696 CTAACTTTTTGATGTGCTGCTGG - Intronic
1050852406 9:10304036-10304058 TGAGCGTTTTGATGTGCTGCTGG - Intronic
1050942819 9:11482115-11482137 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1051089596 9:13390731-13390753 TTCACTTTTTGATGTGCTGCTGG - Intergenic
1051442896 9:17105623-17105645 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1051479768 9:17546750-17546772 TACACTTTTTGATGTGCTGCTGG - Intergenic
1051524359 9:18026573-18026595 ATTAACTTTTGATGTGCTGCTGG + Intergenic
1051578616 9:18646757-18646779 ATAACTTTTTGATGTGCTGCTGG + Intronic
1051927633 9:22348279-22348301 TTTAAGGTTTTATGTTCTACTGG + Intergenic
1051933058 9:22410036-22410058 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1051968436 9:22858477-22858499 TTAGCTTTTTCATGTGCTGCTGG - Intergenic
1052078857 9:24178688-24178710 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1052094301 9:24365946-24365968 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1052280869 9:26731966-26731988 TAAACTTTTTCATGTGCTGCTGG + Intergenic
1052451613 9:28638187-28638209 GATAAGTTTTGATGTGCTGCTGG + Intronic
1052475121 9:28949895-28949917 TAAACTTTTTAATGTGCTGCAGG - Intergenic
1052475132 9:28950017-28950039 TAAACTTTTTAATGTGCTGCTGG - Intergenic
1053542583 9:38990063-38990085 TTAAATTTTTGATGTGCTGCTGG + Intergenic
1053548540 9:39049852-39049874 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1053605790 9:39657221-39657243 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1053622811 9:39837543-39837565 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1053636173 9:40007253-40007275 TGAACTTTTTGATGTGCTGCTGG - Intergenic
1053769816 9:41457399-41457421 TGAACTTTTTGATGTGCTGCTGG + Intergenic
1053807038 9:41813580-41813602 TTAAATTTTTGATGTGCTGCTGG + Intergenic
1053812662 9:41869916-41869938 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1053863707 9:42413845-42413867 TTAACTTTTTGATGTGCTGCGGG + Intergenic
1053882053 9:42605538-42605560 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1053890615 9:42688749-42688771 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1054221078 9:62413004-62413026 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1054229636 9:62496168-62496190 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1054247754 9:62685195-62685217 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1054317045 9:63604348-63604370 TGAACTTTTTGATGTGCTGCTGG - Intergenic
1054548489 9:66368874-66368896 TGAACTTTTTGATGTGCTGCTGG + Intergenic
1054561870 9:66719720-66719742 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1054617933 9:67317523-67317545 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1054623554 9:67373847-67373869 TTAAATTTTTGATGTGCTGCTGG - Intergenic
1054844408 9:69777799-69777821 TTTATGTTTTTCTTTGCTGTTGG + Intergenic
1055168659 9:73227538-73227560 TACACTTTTTGATGTGCTGCTGG - Intergenic
1055222663 9:73955887-73955909 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1055226754 9:74006329-74006351 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1055373025 9:75620724-75620746 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1055811333 9:80151722-80151744 TTAACTTTTTGATGAGCTGCTGG + Intergenic
1055912184 9:81365180-81365202 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1055993202 9:82130104-82130126 TTTATGTTTTTATGGACGGCGGG - Intergenic
1056222034 9:84459397-84459419 TTCGCTTTTTGATGTGCTGCTGG + Intergenic
1056375059 9:86000266-86000288 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1056866915 9:90235577-90235599 TTAACTTTTTGATGTGCTACTGG + Intergenic
1057768757 9:97947709-97947731 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1057881900 9:98798429-98798451 TTGACTTTTTGATGTGCTGCTGG - Intergenic
1058199727 9:102024606-102024628 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1058208097 9:102133176-102133198 TAAACTTTTTTATGTGCTGCTGG + Intergenic
1058221283 9:102306517-102306539 TTATCTTTTTGATGTGCTGCTGG + Intergenic
1058235959 9:102490321-102490343 TTAACTTTTTGATGTGCTCCTGG - Intergenic
1058461209 9:105185100-105185122 TTCATTTTTTGATGTGCTGCTGG + Intergenic
1058512103 9:105730438-105730460 TAAACTTTTTGATGTGCTGCTGG + Intronic
1058616350 9:106832536-106832558 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1058916505 9:109571752-109571774 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1059990928 9:119865099-119865121 GTAACTTTTTGATGTGCTGCTGG - Intergenic
1059992970 9:119882641-119882663 TCTGCTTTTTTATGTGCTCCAGG + Intergenic
1060868169 9:127016305-127016327 ATAACGTTTTTATGTAATGCCGG + Intronic
1062298067 9:135845139-135845161 TAAACTTTTTGATGTGCTGCTGG - Intronic
1203429401 Un_GL000195v1:76942-76964 TGCACTTTTTAATGTGCTGCTGG - Intergenic
1203436899 Un_GL000195v1:146362-146384 TGAACTTTTTAATGTGCTGCTGG + Intergenic
1203533916 Un_KI270743v1:12800-12822 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1186006983 X:5083338-5083360 TTTGTGTTTTTATGTACTTCTGG - Intergenic
1186372611 X:8962672-8962694 TTAGCTTTTTCATGTGCTGCTGG - Intergenic
1186563894 X:10641789-10641811 TAAACGTTTTGATGTGCTGCTGG - Intronic
1186897959 X:14023723-14023745 TTAATGTCATTATGTGCTGCAGG - Intronic
1186960039 X:14726409-14726431 TTTAAGGTTTTATGTGCAGGAGG - Intronic
1187105044 X:16233058-16233080 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1187115279 X:16343203-16343225 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1187271456 X:17783740-17783762 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1187303037 X:18069899-18069921 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1187325510 X:18283072-18283094 TTAACTTTTTGATGTGCTGCTGG - Intronic
1187640333 X:21281060-21281082 TTATCTTTTTGATGTGCTGCTGG + Intergenic
1187756120 X:22528698-22528720 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1187767573 X:22660295-22660317 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1187845790 X:23535617-23535639 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1188001475 X:24986573-24986595 TTTACATTTTTATGTGGAGATGG - Intronic
1188035296 X:25311143-25311165 TTAGCTTTTCTATGTGCTGCTGG + Intergenic
1188064494 X:25641835-25641857 TTTACCTGTTCATCTGCTGCTGG + Intergenic
1188109355 X:26178906-26178928 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1188230062 X:27651163-27651185 TTAACCTTTTGATGTGTTGCTGG + Intronic
1188406468 X:29816697-29816719 TTAACTTTTTGATGTGCTGCTGG - Intronic
1188644689 X:32551259-32551281 TTAGCTTTTTGATGTGCTGCTGG - Intronic
1188796860 X:34477877-34477899 TTAGCCTTTTGATGTGCTGCTGG + Intergenic
1188958086 X:36458133-36458155 TTATCTTTTTGATGTGCTGCTGG - Intergenic
1188969690 X:36598574-36598596 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1189547997 X:42062924-42062946 TTAAGTTTTTAATGTGCTGCTGG + Intergenic
1189582977 X:42427229-42427251 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1189659531 X:43282201-43282223 TTCACTTTTTGATGTGCTGCTGG + Intergenic
1189678618 X:43490452-43490474 TTCACTTTTTTATGTGCTGATGG - Intergenic
1189887251 X:45560524-45560546 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1189891523 X:45607873-45607895 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1189898076 X:45676770-45676792 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1190027945 X:46943583-46943605 TTAACTTTTTAATGTGTTGCTGG + Intronic
1190555178 X:51626878-51626900 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1190604121 X:52122922-52122944 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1190608972 X:52174541-52174563 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1191068294 X:56373888-56373910 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1191099321 X:56708092-56708114 ATATCTTTTTTATGTGCTGCTGG + Intergenic
1191173184 X:57470868-57470890 TAAGCTTTTTTATGTGCTGCTGG - Intronic
1191196367 X:57727846-57727868 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1191747420 X:64504618-64504640 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1191774362 X:64797025-64797047 TTACCTTTTTCATGTGCTGCTGG - Intergenic
1191817155 X:65258159-65258181 TTAACTTTTTGATGTGCTGTTGG - Intergenic
1191860373 X:65661480-65661502 TTAACTTTTTGACGTGCTGCTGG + Intronic
1191877949 X:65815277-65815299 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1191944034 X:66511249-66511271 TTAGTGTTTTGATGTGCTGCTGG + Intergenic
1191973291 X:66841646-66841668 TATGCTTTTTGATGTGCTGCTGG - Intergenic
1191989061 X:67012770-67012792 TTATCTTTTTGATGTGCTGCTGG - Intergenic
1192067307 X:67899784-67899806 TTAGCTTTTTTATGTGCTGCTGG + Intergenic
1192397039 X:70792966-70792988 TTAACTTTTTAATGTGTTGCTGG - Intronic
1192528143 X:71865528-71865550 TTTTCCTTTTTATGTCCTGTAGG - Intergenic
1192629507 X:72765709-72765731 TTTTCTTTTTGATGTGCTGTTGG + Intergenic
1192652203 X:72955105-72955127 TTTTCTTTTTGATGTGCTGTTGG - Intergenic
1192689838 X:73350451-73350473 TTTAGCTTTTGATGTACTGCTGG + Intergenic
1192710211 X:73574295-73574317 TTAACTTTTTGATGTGCTGCTGG + Intronic
1192711301 X:73592573-73592595 TTAATTTTTTGATGTGCTGCTGG + Intronic
1192724593 X:73735287-73735309 TTAACTTTTTGATGTGCTGTTGG + Intergenic
1192756683 X:74053600-74053622 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1192857898 X:75033600-75033622 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1192870851 X:75182223-75182245 TTAGCATTTTGATGTGCTGCTGG + Intergenic
1192956817 X:76080309-76080331 TTTGCTTTTTGATATGCTGCTGG - Intergenic
1192982629 X:76362831-76362853 TTAGCTTTTTAATGTGCTGCTGG + Intergenic
1192984600 X:76383458-76383480 TTAAGATTTTCATGTGCTGCTGG - Intergenic
1193006258 X:76621649-76621671 CTTTTCTTTTTATGTGCTGCTGG - Intergenic
1193024787 X:76834579-76834601 TTAACTTTTTGATGTGCTCCTGG + Intergenic
1193146232 X:78078730-78078752 TAAACTTTTTGATGTGCTGCTGG + Intronic
1193200102 X:78679281-78679303 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1193266686 X:79480326-79480348 TTGACTTTTTAATGTGCTGCTGG + Intergenic
1193281178 X:79652765-79652787 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1193291108 X:79773914-79773936 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1193309565 X:79989635-79989657 TAAACTTTTTAATGTGCTGCTGG - Intergenic
1193317346 X:80078560-80078582 TTAACTTTTTAATATGCTGCTGG + Intergenic
1193330465 X:80230384-80230406 TTAACTTTTTGATGTGCAGCTGG + Intergenic
1193334987 X:80277515-80277537 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1193381801 X:80824574-80824596 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1193385359 X:80864823-80864845 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1193404811 X:81087686-81087708 TAAGCGTTTTGATGTGCTGCTGG - Intergenic
1193433089 X:81436511-81436533 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1193436580 X:81481057-81481079 CTAACTTTTTGATGTGCTGCTGG - Intergenic
1193452997 X:81693824-81693846 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1193461406 X:81794832-81794854 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1193502832 X:82301128-82301150 TTAACTTTTTGATGTTCTGCTGG - Intergenic
1193513802 X:82437965-82437987 TTAACATTTTGATGTGCTGTTGG - Intergenic
1193558959 X:82993886-82993908 TTAGCATTTTTATGTGATGCTGG + Intergenic
1193571325 X:83148796-83148818 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1193624996 X:83807870-83807892 TTAACTTTTTGATGTGATGCTGG + Intergenic
1193663480 X:84286177-84286199 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1193671009 X:84386222-84386244 TTAACTTTTGGATGTGCTGCTGG + Intronic
1193714579 X:84923117-84923139 TTAACTTTTTGATGTGCTGCTGG + Intergenic
1193868662 X:86768940-86768962 TTAACTTTTTGATGTGCTGGTGG - Intronic
1193902230 X:87195356-87195378 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1193979645 X:88166073-88166095 TCCACTTTTTGATGTGCTGCTGG + Intergenic
1194024250 X:88732021-88732043 CATACTTTTTGATGTGCTGCCGG + Intergenic
1194037097 X:88888104-88888126 ATTACTTTTTGATGTGCTGCTGG + Intergenic
1194078981 X:89433903-89433925 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1194080227 X:89453607-89453629 TTAGCTTTTTTATGTGCTGCTGG - Intergenic
1194121412 X:89967824-89967846 TTTACTTTTTGATGTGCTGCTGG + Intergenic
1194211061 X:91069702-91069724 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1194238267 X:91411596-91411618 TTCACTTTTTGATGTGCTGCTGG - Intergenic
1194251553 X:91581748-91581770 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1194292684 X:92094110-92094132 ATTACTTTTTTGTGTGGTGCTGG - Intronic
1194433671 X:93843031-93843053 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1194504165 X:94712180-94712202 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1194625124 X:96218295-96218317 AATAAGTTTTGATGTGCTGCTGG - Intergenic
1194805521 X:98322324-98322346 TTTACTTTTTGATGTGCTGCTGG - Intergenic
1194814596 X:98426697-98426719 TAAGCGTTTTGATGTGCTGCTGG + Intergenic
1194854383 X:98911305-98911327 ATTTGCTTTTTATGTGCTGCTGG + Intergenic
1194898294 X:99472538-99472560 TTAACTTTTTAATGTGCTGCTGG - Intergenic
1194910320 X:99633349-99633371 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1194922916 X:99789713-99789735 TTAACTATTTTATATGCTGCTGG + Intergenic
1195024184 X:100859300-100859322 TTAGCTTTTTGATGTGCTGCTGG + Intronic
1195153012 X:102093441-102093463 TCTACTTTTTTATGTGCTGTGGG + Intergenic
1195508602 X:105687845-105687867 TATGCTTTTTGATGTGCTGCGGG - Intronic
1195544120 X:106096150-106096172 TTAGCTTTTTAATGTGCTGCTGG + Intergenic
1195735107 X:108004571-108004593 TTAACTTTTTGTTGTGCTGCTGG - Intergenic
1195827103 X:109014138-109014160 GATAAGTTTTGATGTGCTGCTGG - Intergenic
1195836146 X:109116944-109116966 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1195930993 X:110075827-110075849 TTAACTATTTGATGTGCTGCTGG + Intronic
1195996335 X:110735438-110735460 TCTAGGTTTTGATGTGGTGCAGG - Intronic
1196028239 X:111065423-111065445 TTATCTTTTTGATGTGCTGCTGG + Intronic
1196240397 X:113337319-113337341 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1196244749 X:113387764-113387786 TTCGCTTTTTGATGTGCTGCGGG + Intergenic
1196512684 X:116530897-116530919 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1196516694 X:116621627-116621649 TTAATTTTTTCATGTGCTGCTGG + Intergenic
1196536678 X:116853553-116853575 TTATCATTTTGATGTGCTGCTGG + Intergenic
1196562517 X:117167599-117167621 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1196933060 X:120700499-120700521 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1197003208 X:121464135-121464157 TTTATGTTTTTTTGTGTTGTAGG + Intergenic
1197031777 X:121824823-121824845 TTAACTTTTTGATGTGCTGTTGG - Intergenic
1197107574 X:122733834-122733856 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1197191439 X:123652054-123652076 TAAACTTTTTGATGTGCTGCTGG - Intronic
1197235866 X:124062057-124062079 TATACTTTTTTAGTTGCTGCAGG + Intronic
1197255100 X:124254203-124254225 TTTACGTATTTATTTACTGGGGG + Intronic
1197349477 X:125365699-125365721 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1197392793 X:125888750-125888772 TTAAATTTTTGATGTGCTGCTGG + Intergenic
1197406783 X:126063756-126063778 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1197438628 X:126462896-126462918 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1197562711 X:128044002-128044024 TTAACTCTTTGATGTGCTGCTGG + Intergenic
1197573711 X:128181452-128181474 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1197579024 X:128258733-128258755 TTAACTTTTTAATGTCCTGCTGG - Intergenic
1197600927 X:128528764-128528786 TTTACTTTTTGATATGCTGCTGG - Intergenic
1198169042 X:134087200-134087222 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1198579924 X:138052100-138052122 TTAGCTTTTTGATGTGCTGCTGG - Intergenic
1198609906 X:138386758-138386780 TTAACTTTTCGATGTGCTGCTGG - Intergenic
1198710656 X:139498631-139498653 TTTATATTTTTTTGTGGTGCAGG - Intergenic
1198784123 X:140269246-140269268 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1198891195 X:141398737-141398759 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1198976026 X:142337010-142337032 TTAACTTTTTGATGTGCTGCTGG - Intergenic
1199099022 X:143776668-143776690 CTAACTTTTTGATGTGCTGCTGG + Intergenic
1199106978 X:143880463-143880485 TTAACGTTTTGATGTGCTGCTGG - Intergenic
1199197808 X:145052467-145052489 TTGGCTTTTTTACGTGCTGCTGG - Intergenic
1199227138 X:145390679-145390701 TTAACTTTTTGATGTGCTACTGG + Intergenic
1199253444 X:145691407-145691429 TTAACTTTTCGATGTGCTGCTGG + Intergenic
1199306712 X:146275729-146275751 ATTAGTTTTTGATGTGCTGCTGG + Intergenic
1199400505 X:147393520-147393542 TTAGGCTTTTTATGTGCTGCTGG - Intergenic
1199481391 X:148302116-148302138 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1199706772 X:150433776-150433798 TTAGCTTTTTGATGTGCTGCCGG + Intronic
1200431604 Y:3089225-3089247 TTAGCTTTTTGATGTGCTGCTGG + Intergenic
1200432905 Y:3109670-3109692 TTAGCTTTTTTATGTGCTGCTGG - Intergenic
1200474268 Y:3625275-3625297 TTTACTTTTTGATGTGCTGCTGG + Intergenic
1200610187 Y:5318690-5318712 ATTACTTTTTTGTGTGGTGCTGG - Intronic
1200903336 Y:8455803-8455825 TAAGCGTTTTGATGTGCTGCTGG + Intergenic
1201483040 Y:14461146-14461168 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1201492052 Y:14552550-14552572 TAAACTTTTTGATGTGCTGCTGG - Intronic
1201497930 Y:14609581-14609603 TAAACCTTTTGATGTGCTGCTGG + Intronic
1201529223 Y:14973536-14973558 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1202112717 Y:21440537-21440559 TACACTTTTTGATGTGCTGCTGG + Intergenic
1202165821 Y:21986569-21986591 TACACTTTTTGATGTGCTGCTGG + Intergenic
1202225537 Y:22599803-22599825 TACACTTTTTGATGTGCTGCTGG - Intergenic
1202317576 Y:23595858-23595880 TACACTTTTTGATGTGCTGCTGG + Intergenic
1202553189 Y:26074200-26074222 TACACTTTTTGATGTGCTGCTGG - Intergenic