ID: 1107210066

View in Genome Browser
Species Human (GRCh38)
Location 13:37842629-37842651
Sequence CTGTGTTCCCACATGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2025
Summary {0: 1, 1: 14, 2: 108, 3: 566, 4: 1336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107210061_1107210066 11 Left 1107210061 13:37842595-37842617 CCCAACTTTCTAGTTCATAGATG 0: 1
1: 0
2: 3
3: 27
4: 206
Right 1107210066 13:37842629-37842651 CTGTGTTCCCACATGGTGAAAGG 0: 1
1: 14
2: 108
3: 566
4: 1336
1107210062_1107210066 10 Left 1107210062 13:37842596-37842618 CCAACTTTCTAGTTCATAGATGG 0: 1
1: 42
2: 230
3: 463
4: 880
Right 1107210066 13:37842629-37842651 CTGTGTTCCCACATGGTGAAAGG 0: 1
1: 14
2: 108
3: 566
4: 1336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107210066 Original CRISPR CTGTGTTCCCACATGGTGAA AGG Intronic
Too many off-targets to display for this crispr