ID: 1107212996

View in Genome Browser
Species Human (GRCh38)
Location 13:37880674-37880696
Sequence CTTTGTAAGGCCAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107212996_1107213003 11 Left 1107212996 13:37880674-37880696 CCTCCCACCTTGGCCTTACAAAG No data
Right 1107213003 13:37880708-37880730 CAAGCATGAGCCACCATGCCTGG 0: 383
1: 10125
2: 43919
3: 106671
4: 178529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107212996 Original CRISPR CTTTGTAAGGCCAAGGTGGG AGG (reversed) Intergenic
No off target data available for this crispr