ID: 1107213604

View in Genome Browser
Species Human (GRCh38)
Location 13:37888666-37888688
Sequence GTGTATGATTGATGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107213604_1107213607 9 Left 1107213604 13:37888666-37888688 CCTATTTCCCATCAATCATACAC No data
Right 1107213607 13:37888698-37888720 TAAACCTAAGAATAGTCCTGAGG No data
1107213604_1107213610 13 Left 1107213604 13:37888666-37888688 CCTATTTCCCATCAATCATACAC No data
Right 1107213610 13:37888702-37888724 CCTAAGAATAGTCCTGAGGAGGG No data
1107213604_1107213608 12 Left 1107213604 13:37888666-37888688 CCTATTTCCCATCAATCATACAC No data
Right 1107213608 13:37888701-37888723 ACCTAAGAATAGTCCTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107213604 Original CRISPR GTGTATGATTGATGGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr