ID: 1107227041

View in Genome Browser
Species Human (GRCh38)
Location 13:38063797-38063819
Sequence TTGTAAGTGCATTAAATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107227040_1107227041 3 Left 1107227040 13:38063771-38063793 CCAAAGAACACATGCTATAAATC No data
Right 1107227041 13:38063797-38063819 TTGTAAGTGCATTAAATGCATGG No data
1107227039_1107227041 7 Left 1107227039 13:38063767-38063789 CCAGCCAAAGAACACATGCTATA No data
Right 1107227041 13:38063797-38063819 TTGTAAGTGCATTAAATGCATGG No data
1107227038_1107227041 20 Left 1107227038 13:38063754-38063776 CCATTTGTCATTTCCAGCCAAAG No data
Right 1107227041 13:38063797-38063819 TTGTAAGTGCATTAAATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107227041 Original CRISPR TTGTAAGTGCATTAAATGCA TGG Intergenic
No off target data available for this crispr