ID: 1107228612

View in Genome Browser
Species Human (GRCh38)
Location 13:38081714-38081736
Sequence TGGGAATACCCTACAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107228607_1107228612 27 Left 1107228607 13:38081664-38081686 CCAGGACATTGACCTGGATGCTT No data
Right 1107228612 13:38081714-38081736 TGGGAATACCCTACAAACACAGG No data
1107228608_1107228612 15 Left 1107228608 13:38081676-38081698 CCTGGATGCTTTTTAGATGTTCT No data
Right 1107228612 13:38081714-38081736 TGGGAATACCCTACAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107228612 Original CRISPR TGGGAATACCCTACAAACAC AGG Intergenic
No off target data available for this crispr