ID: 1107230448

View in Genome Browser
Species Human (GRCh38)
Location 13:38103925-38103947
Sequence CCCTTTCAGGGTAGGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107230448_1107230458 18 Left 1107230448 13:38103925-38103947 CCACAGATCCTACCCTGAAAGGG No data
Right 1107230458 13:38103966-38103988 GCACAATATTGCTGAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107230448 Original CRISPR CCCTTTCAGGGTAGGATCTG TGG (reversed) Intergenic
No off target data available for this crispr