ID: 1107239054

View in Genome Browser
Species Human (GRCh38)
Location 13:38210443-38210465
Sequence CTTTGGGTCTCCCCCTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107239054_1107239061 17 Left 1107239054 13:38210443-38210465 CCTCCTAAGGGGGAGACCCAAAG No data
Right 1107239061 13:38210483-38210505 CATTGCTAGATGATAGTCACAGG No data
1107239054_1107239063 29 Left 1107239054 13:38210443-38210465 CCTCCTAAGGGGGAGACCCAAAG No data
Right 1107239063 13:38210495-38210517 ATAGTCACAGGGTATGTGTCTGG No data
1107239054_1107239062 18 Left 1107239054 13:38210443-38210465 CCTCCTAAGGGGGAGACCCAAAG No data
Right 1107239062 13:38210484-38210506 ATTGCTAGATGATAGTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107239054 Original CRISPR CTTTGGGTCTCCCCCTTAGG AGG (reversed) Intergenic
No off target data available for this crispr