ID: 1107239585

View in Genome Browser
Species Human (GRCh38)
Location 13:38215910-38215932
Sequence TACTCAAAACTGCTGTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107239581_1107239585 5 Left 1107239581 13:38215882-38215904 CCACATCACACAAAATGTTAATG No data
Right 1107239585 13:38215910-38215932 TACTCAAAACTGCTGTGGAATGG No data
1107239579_1107239585 23 Left 1107239579 13:38215864-38215886 CCTACTTGAAACAATCCTCCACA No data
Right 1107239585 13:38215910-38215932 TACTCAAAACTGCTGTGGAATGG No data
1107239580_1107239585 8 Left 1107239580 13:38215879-38215901 CCTCCACATCACACAAAATGTTA No data
Right 1107239585 13:38215910-38215932 TACTCAAAACTGCTGTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107239585 Original CRISPR TACTCAAAACTGCTGTGGAA TGG Intergenic
No off target data available for this crispr