ID: 1107239794

View in Genome Browser
Species Human (GRCh38)
Location 13:38218740-38218762
Sequence CTGTGTCCTCACAGGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107239787_1107239794 9 Left 1107239787 13:38218708-38218730 CCCTACCTGGCTCATAAACAACC No data
Right 1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG No data
1107239788_1107239794 8 Left 1107239788 13:38218709-38218731 CCTACCTGGCTCATAAACAACCC No data
Right 1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG No data
1107239789_1107239794 4 Left 1107239789 13:38218713-38218735 CCTGGCTCATAAACAACCCTCTT No data
Right 1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG No data
1107239785_1107239794 22 Left 1107239785 13:38218695-38218717 CCTGGTGTGGGCTCCCTACCTGG No data
Right 1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107239794 Original CRISPR CTGTGTCCTCACAGGGCAGT AGG Intergenic
No off target data available for this crispr