ID: 1107240192

View in Genome Browser
Species Human (GRCh38)
Location 13:38223671-38223693
Sequence CTGAATCCACAAAAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107240192_1107240196 -7 Left 1107240192 13:38223671-38223693 CCACTCTGCTTTTGTGGATTCAG No data
Right 1107240196 13:38223687-38223709 GATTCAGGGTGACTCTCATTGGG No data
1107240192_1107240198 11 Left 1107240192 13:38223671-38223693 CCACTCTGCTTTTGTGGATTCAG No data
Right 1107240198 13:38223705-38223727 TTGGGAACACAGAGAGGTAATGG No data
1107240192_1107240197 5 Left 1107240192 13:38223671-38223693 CCACTCTGCTTTTGTGGATTCAG No data
Right 1107240197 13:38223699-38223721 CTCTCATTGGGAACACAGAGAGG No data
1107240192_1107240195 -8 Left 1107240192 13:38223671-38223693 CCACTCTGCTTTTGTGGATTCAG No data
Right 1107240195 13:38223686-38223708 GGATTCAGGGTGACTCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107240192 Original CRISPR CTGAATCCACAAAAGCAGAG TGG (reversed) Intergenic
No off target data available for this crispr