ID: 1107241732

View in Genome Browser
Species Human (GRCh38)
Location 13:38243471-38243493
Sequence ACTCCTGGGGTTACAGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107241732_1107241737 -8 Left 1107241732 13:38243471-38243493 CCCACATCTGTAACCCCAGGAGT No data
Right 1107241737 13:38243486-38243508 CCAGGAGTCTGAGATCAGCTTGG 0: 9
1: 189
2: 3749
3: 31929
4: 101483
1107241732_1107241738 -7 Left 1107241732 13:38243471-38243493 CCCACATCTGTAACCCCAGGAGT No data
Right 1107241738 13:38243487-38243509 CAGGAGTCTGAGATCAGCTTGGG 0: 9
1: 171
2: 3663
3: 27557
4: 46567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107241732 Original CRISPR ACTCCTGGGGTTACAGATGT GGG (reversed) Intergenic
No off target data available for this crispr