ID: 1107242107

View in Genome Browser
Species Human (GRCh38)
Location 13:38248690-38248712
Sequence CAGAAGAAGGAGGAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107242107_1107242112 -2 Left 1107242107 13:38248690-38248712 CCTTTCTCCTCCTCCTTCTTCTG No data
Right 1107242112 13:38248711-38248733 TGCTGTTCTGGCTCCATTTCAGG No data
1107242107_1107242114 20 Left 1107242107 13:38248690-38248712 CCTTTCTCCTCCTCCTTCTTCTG No data
Right 1107242114 13:38248733-38248755 GAACATCCCGTGTCCAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107242107 Original CRISPR CAGAAGAAGGAGGAGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr