ID: 1107242112

View in Genome Browser
Species Human (GRCh38)
Location 13:38248711-38248733
Sequence TGCTGTTCTGGCTCCATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107242108_1107242112 -9 Left 1107242108 13:38248697-38248719 CCTCCTCCTTCTTCTGCTGTTCT No data
Right 1107242112 13:38248711-38248733 TGCTGTTCTGGCTCCATTTCAGG No data
1107242106_1107242112 -1 Left 1107242106 13:38248689-38248711 CCCTTTCTCCTCCTCCTTCTTCT No data
Right 1107242112 13:38248711-38248733 TGCTGTTCTGGCTCCATTTCAGG No data
1107242104_1107242112 3 Left 1107242104 13:38248685-38248707 CCTCCCCTTTCTCCTCCTCCTTC No data
Right 1107242112 13:38248711-38248733 TGCTGTTCTGGCTCCATTTCAGG No data
1107242105_1107242112 0 Left 1107242105 13:38248688-38248710 CCCCTTTCTCCTCCTCCTTCTTC 0: 11
1: 118
2: 1094
3: 3826
4: 12935
Right 1107242112 13:38248711-38248733 TGCTGTTCTGGCTCCATTTCAGG No data
1107242107_1107242112 -2 Left 1107242107 13:38248690-38248712 CCTTTCTCCTCCTCCTTCTTCTG No data
Right 1107242112 13:38248711-38248733 TGCTGTTCTGGCTCCATTTCAGG No data
1107242103_1107242112 18 Left 1107242103 13:38248670-38248692 CCTTGTCTGCATCTACCTCCCCT No data
Right 1107242112 13:38248711-38248733 TGCTGTTCTGGCTCCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107242112 Original CRISPR TGCTGTTCTGGCTCCATTTC AGG Intergenic
No off target data available for this crispr