ID: 1107247161

View in Genome Browser
Species Human (GRCh38)
Location 13:38310136-38310158
Sequence TGGTTTGATGCTGTATTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107247161_1107247164 1 Left 1107247161 13:38310136-38310158 CCACACAATACAGCATCAAACCA No data
Right 1107247164 13:38310160-38310182 GCAAACTACTCTACAGTGAAGGG No data
1107247161_1107247167 14 Left 1107247161 13:38310136-38310158 CCACACAATACAGCATCAAACCA No data
Right 1107247167 13:38310173-38310195 CAGTGAAGGGACCGTGGGAGTGG No data
1107247161_1107247166 9 Left 1107247161 13:38310136-38310158 CCACACAATACAGCATCAAACCA No data
Right 1107247166 13:38310168-38310190 CTCTACAGTGAAGGGACCGTGGG No data
1107247161_1107247165 8 Left 1107247161 13:38310136-38310158 CCACACAATACAGCATCAAACCA No data
Right 1107247165 13:38310167-38310189 ACTCTACAGTGAAGGGACCGTGG No data
1107247161_1107247163 0 Left 1107247161 13:38310136-38310158 CCACACAATACAGCATCAAACCA No data
Right 1107247163 13:38310159-38310181 AGCAAACTACTCTACAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107247161 Original CRISPR TGGTTTGATGCTGTATTGTG TGG (reversed) Intergenic
No off target data available for this crispr