ID: 1107247166

View in Genome Browser
Species Human (GRCh38)
Location 13:38310168-38310190
Sequence CTCTACAGTGAAGGGACCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107247159_1107247166 18 Left 1107247159 13:38310127-38310149 CCATATCACCCACACAATACAGC No data
Right 1107247166 13:38310168-38310190 CTCTACAGTGAAGGGACCGTGGG No data
1107247161_1107247166 9 Left 1107247161 13:38310136-38310158 CCACACAATACAGCATCAAACCA No data
Right 1107247166 13:38310168-38310190 CTCTACAGTGAAGGGACCGTGGG No data
1107247158_1107247166 23 Left 1107247158 13:38310122-38310144 CCAAACCATATCACCCACACAAT No data
Right 1107247166 13:38310168-38310190 CTCTACAGTGAAGGGACCGTGGG No data
1107247160_1107247166 10 Left 1107247160 13:38310135-38310157 CCCACACAATACAGCATCAAACC No data
Right 1107247166 13:38310168-38310190 CTCTACAGTGAAGGGACCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107247166 Original CRISPR CTCTACAGTGAAGGGACCGT GGG Intergenic
No off target data available for this crispr