ID: 1107247918

View in Genome Browser
Species Human (GRCh38)
Location 13:38319747-38319769
Sequence CCCAGCGGGTACCCCGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107247905_1107247918 26 Left 1107247905 13:38319698-38319720 CCGTGTTGGCCAGGATGGTCAGC No data
Right 1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG No data
1107247908_1107247918 17 Left 1107247908 13:38319707-38319729 CCAGGATGGTCAGCTTGTTGGGG No data
Right 1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG No data
1107247911_1107247918 -9 Left 1107247911 13:38319733-38319755 CCAGCCCCACACCACCCAGCGGG No data
Right 1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107247918 Original CRISPR CCCAGCGGGTACCCCGAGTC CGG Intergenic
No off target data available for this crispr