ID: 1107251445

View in Genome Browser
Species Human (GRCh38)
Location 13:38368295-38368317
Sequence AGTAGTCTGAAGAAGAGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107251445 Original CRISPR AGTAGTCTGAAGAAGAGGAC GGG Intergenic
900208149 1:1440232-1440254 AGGCTTCTGAAGAAGAGGAAGGG + Exonic
901564501 1:10101849-10101871 AGTATTCTGAGGAAAATGACTGG + Intronic
904655917 1:32046972-32046994 GGTAGTCTGAAGAAGAAAAATGG + Intronic
905173203 1:36121282-36121304 AGGAGTCTGAAGCAGAAGAATGG + Intronic
907435377 1:54442534-54442556 AGTAGGCTAAAGAAGAAGCCAGG - Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907791499 1:57669842-57669864 AGAAGTCTGAAAAACAGTACAGG + Intronic
909361156 1:74760195-74760217 AGTAGGCTGAGGAAGAGGAGTGG + Intronic
909391519 1:75126404-75126426 AGTATTCTGAAGGAGAGGAGGGG + Intergenic
910534987 1:88287435-88287457 ACTTGTCTGAATAAGAGGAGAGG + Intergenic
910669008 1:89754250-89754272 ATTAGCCTGGAAAAGAGGACAGG - Intronic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911546033 1:99217968-99217990 AATATTCTGAATAAGAGGAGAGG - Intergenic
912249853 1:107999878-107999900 AGTAGAATGAAGGAGAGGAGTGG - Intergenic
913041001 1:115023003-115023025 AGCTGTGTGAAGAAGATGACTGG + Intergenic
913327081 1:117636649-117636671 AGTAGTCTAAAAAAAATGACAGG - Intergenic
913972727 1:143426863-143426885 AGTACTATGTTGAAGAGGACTGG + Intergenic
914067111 1:144252477-144252499 AGTACTATGTTGAAGAGGACTGG + Intergenic
914112042 1:144713877-144713899 AGTACTATGTTGAAGAGGACTGG - Intergenic
917250073 1:173049367-173049389 AGATTTCTGAAGAAGAGGAAGGG - Intronic
918662054 1:187101284-187101306 TTTAGCCTGAAGAAGAGGATGGG - Intergenic
919278199 1:195448377-195448399 AGTACTATGTAGAAGAGGAGTGG - Intergenic
920158815 1:203979519-203979541 TGTGGTCTGAGGAATAGGACAGG + Intergenic
920268868 1:204747776-204747798 AGGAGCCTGCAGAAGAGGAGAGG + Intergenic
921251308 1:213300954-213300976 TGGAGTGTGAAGAAGAGGATCGG - Intergenic
921834850 1:219767829-219767851 AGTACTATGTTGAAGAGGACTGG - Intronic
922763627 1:228146825-228146847 AGTAATCTGGGGAAGAGGAGGGG - Exonic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
922781757 1:228257914-228257936 AATAGCCTTAAGAAGAGGCCGGG - Intronic
923803663 1:237235057-237235079 AGAAGTGTGGAGAAGAGGCCTGG - Intronic
924465128 1:244292649-244292671 AGTAGGCTGAGGAGGAGGAGGGG + Intergenic
924866846 1:247992095-247992117 AGTAGTAGGAAGAGGAGGAGAGG - Intronic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1065064212 10:21943450-21943472 AGTAGGCAGAAGCAGAGGAAAGG - Intronic
1065699473 10:28410940-28410962 AGAAATCTGAAGAAGAAGAGGGG + Intergenic
1067025497 10:42840213-42840235 AGTAGGCTGAAGAAGAGAAGAGG + Intergenic
1068020077 10:51570472-51570494 AGTAGTCTGAAGAAGAGGAAGGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1069733281 10:70633384-70633406 AGTAGGCTGAAGAAAGGGAGGGG - Intergenic
1070351101 10:75592876-75592898 ATAAGACTGAAGAAAAGGACAGG - Intronic
1071023860 10:81089237-81089259 AGTACTATGTTGAAGAGGACTGG + Intergenic
1071130748 10:82390733-82390755 ACTTCTCTGCAGAAGAGGACTGG + Intronic
1072026376 10:91463356-91463378 AGTAGGCTGAGGAAGAGGAGGGG + Intronic
1072363441 10:94683576-94683598 ACTAGTCTGAAGCAGAGCCCAGG - Intergenic
1072382147 10:94884329-94884351 AGTACTATGTAGAATAGGACAGG - Intergenic
1072687189 10:97544927-97544949 AGTAGGCTGAGGAGGAGGAAAGG + Intronic
1074341330 10:112633154-112633176 AGAGGTCTGAAGGAGAGGAGAGG + Intronic
1074534336 10:114317922-114317944 AGCAGTCAGCAGAAGGGGACTGG + Intronic
1077896991 11:6460499-6460521 ATTGGCCTGAAGAGGAGGACTGG + Intronic
1078002115 11:7505372-7505394 AGTAGTCTTAATAAGAGCATAGG - Intronic
1078236362 11:9488526-9488548 TGAAGACTGAAGAAGAGGACTGG - Intronic
1079856471 11:25611284-25611306 AGGACTCAGAAGAAGATGACAGG - Intergenic
1081925996 11:46829224-46829246 AATAGGCTGAGGAAGAGGAGGGG - Intronic
1084158937 11:67334076-67334098 AGTAGGCTGAGGAAGAGGAATGG - Intronic
1084456411 11:69270386-69270408 AGGAGTCTGGAGAAGGGGACGGG + Intergenic
1085489347 11:76900255-76900277 AGTAAGCTGAGGAAGAGGAGGGG + Intronic
1085661469 11:78371270-78371292 AGTAGTCTAATGAAAAGGGCAGG + Intronic
1086482312 11:87255213-87255235 AGGGGTCGGAAGAAGAGGGCAGG + Intronic
1087207865 11:95416329-95416351 AAGAGGCTGAAGAAGAGAACAGG - Intergenic
1087505273 11:99013012-99013034 AGTAGGCTGAAGAGGAGGAAGGG + Intergenic
1087854652 11:103077093-103077115 AGGAGTCTGAAGCAGGGGAATGG + Intronic
1088544020 11:110941922-110941944 AGTAGGCTGAGGAGGAGGAAGGG + Intergenic
1090197236 11:124827129-124827151 AGTAGACTGAAGATGGGGAAGGG - Intergenic
1090437668 11:126700397-126700419 AACACTCTGAAGAACAGGACCGG + Intronic
1091636288 12:2199339-2199361 AGTAGACTGAGGAGGAGGAAGGG - Intronic
1091685133 12:2556194-2556216 AGGAGGCTGGAGAAGAGGGCAGG - Intronic
1092932774 12:13332674-13332696 AGGAGGAGGAAGAAGAGGACGGG - Intergenic
1092990727 12:13896355-13896377 AATAGACTCAAGAAGAGGATAGG + Intronic
1093705276 12:22268224-22268246 AGTGGTCTGAAAAAGGGAACAGG - Intronic
1093897253 12:24588237-24588259 AGGAGGCTGAAGCAGAGGAATGG + Intergenic
1094748762 12:33379918-33379940 AGGAGTGTGCAGAACAGGACTGG - Exonic
1095531713 12:43194309-43194331 AGTAGTATGTTGAAGAGGAGTGG + Intergenic
1097394687 12:59059450-59059472 AGTAGTCTTAAGAAGCAGTCAGG + Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098800482 12:74951052-74951074 AGTAGGCTGAGGAGGAGGAGCGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099516798 12:83606674-83606696 AGTACTATGTAGAAGAGGAGTGG - Intergenic
1100647612 12:96547805-96547827 AGTAGGAAGAGGAAGAGGACAGG - Intronic
1100821528 12:98436154-98436176 AGTAGGCTGAGGAGGAGGAGAGG - Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101309982 12:103568733-103568755 AGTAGTGTGTTGAAGAGGAGTGG - Intergenic
1103806926 12:123580954-123580976 AGTAGGCTGAAGAGGAGGGGAGG - Intergenic
1107152430 13:37127792-37127814 AATAGTCTGAATCATAGGACTGG - Intergenic
1107251445 13:38368295-38368317 AGTAGTCTGAAGAAGAGGACGGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1110049472 13:70876384-70876406 AGTAGTCAGATGGAGAGGTCAGG + Intergenic
1110257460 13:73447306-73447328 AGTTGTCTGTAGAAGTGAACAGG + Intergenic
1110688352 13:78401965-78401987 AGTGGACTGCAGAAAAGGACTGG - Intergenic
1112747655 13:102545150-102545172 AGTAGTATGTTGAAGAGGAGTGG - Intergenic
1113004218 13:105680121-105680143 AGTTGTCTGAAAGAGAGGAGAGG + Intergenic
1114196826 14:20485493-20485515 AGTAGACTGAACAAGGGGAATGG + Intergenic
1114268262 14:21085672-21085694 AGCAGTCTGAGGAAGAGCAGAGG - Exonic
1114287484 14:21258979-21259001 AGGATTTTGAAGAAGAGGTCTGG - Intronic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115727529 14:36233490-36233512 AGAAGTCTGAAATACAGGACAGG + Intergenic
1116731550 14:48628915-48628937 AGTAGTTTGAAGCAGAGAAAGGG - Intergenic
1119103939 14:71906508-71906530 ATCAGTCTGAGGAAGAGGAAGGG - Intergenic
1120177221 14:81307668-81307690 AGTAGGCTGAGGAAGAGGAGGGG - Intronic
1121793286 14:96714946-96714968 AGTAGGCTGAGGAGGAGGAAGGG - Intergenic
1121927557 14:97942463-97942485 AGTAGCAAGAAGAAGAGGAAGGG + Intronic
1122167766 14:99842415-99842437 ATTAATCTGAAGAATACGACTGG - Intronic
1122257867 14:100492323-100492345 GGGAGGCTGAAGAGGAGGACTGG - Intronic
1122985808 14:105211162-105211184 AGGAGCCTGACGAGGAGGACGGG - Exonic
1123426127 15:20171668-20171690 AGTAGGCTGAAGAAGAGAAGAGG + Intergenic
1123535359 15:21178195-21178217 AGTAGGCTGAAGAAGAGAAGAGG + Intergenic
1124381061 15:29166284-29166306 AGTAGTATGTTGAAGAGGAGTGG - Intronic
1124386410 15:29211506-29211528 AGTAGTGTGTTGAAGAGGAGTGG + Intronic
1124448121 15:29757914-29757936 AGTCGTCTGAGGAATAGGAGAGG - Intronic
1124857130 15:33400023-33400045 AGGAGTCAGAAGAAGAGGGGAGG - Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127837936 15:62805848-62805870 TGTAGTCTGAAAAAGGGGAGGGG + Intronic
1129717253 15:77859660-77859682 AGGAGCCTGGAGAAGAGGAGGGG + Intergenic
1131889360 15:96955883-96955905 AGAAGACTGATGAAGAGGTCTGG - Intergenic
1133280444 16:4662093-4662115 AGCAGTCAGGAGAAGGGGACGGG - Intronic
1133454233 16:5929149-5929171 AGTAGTCTTGGGAAGCGGACAGG + Intergenic
1134358423 16:13506465-13506487 AGGAGTGTGATGAGGAGGACGGG + Intergenic
1135984656 16:27175285-27175307 AAGAGGCTGAAGAAGAGAACTGG - Intergenic
1136858130 16:33677843-33677865 AGTAGGCTGAAGAAGAGAAGAGG - Intergenic
1137380523 16:47994613-47994635 ACTGGTCTGAAGCAGAGGAAAGG - Intergenic
1137404672 16:48179990-48180012 CTTAGTCTGAAAAAGAGGCCAGG + Intronic
1139461189 16:67123724-67123746 AGTAGGCAGAAGAAGAGGACAGG - Intronic
1139571713 16:67816923-67816945 AGTAGACAGAACACGAGGACTGG + Intronic
1140402495 16:74682972-74682994 AGTATTATGGAGAAGAGGATGGG - Intronic
1140682372 16:77398014-77398036 AGTAATCTAAAGAAGAGGAAGGG + Intronic
1141375410 16:83525809-83525831 TGAAGACTGAAGAAGAGAACGGG + Intronic
1203119695 16_KI270728v1_random:1526315-1526337 AGTAGGCTGAAGAAAAGAAGAGG - Intergenic
1143480364 17:7224583-7224605 ATTAGTCTCAAGGAGAGGAAAGG - Intronic
1143924242 17:10355701-10355723 AGTAGTCCCAAGAAGAGAGCTGG - Intronic
1144133904 17:12274475-12274497 AGTAGGCTGAGGAAGAGGAGGGG - Intergenic
1144284879 17:13764214-13764236 AGTACTTTGAACAAGAGGACTGG - Intergenic
1145818691 17:27814348-27814370 AGTAGGTTGAGGAAGAGGAGTGG + Intronic
1146269163 17:31473179-31473201 AGGAGTCTGCACAAGAGGCCAGG + Intronic
1146304818 17:31722804-31722826 AGCAGGCTGATGCAGAGGACTGG + Intergenic
1146461757 17:33051517-33051539 AGGAGTCTCAAGAAGATGCCAGG - Intronic
1147397751 17:40157967-40157989 AGTAGACTTCAGAAGAGGAGGGG + Intronic
1148384933 17:47227585-47227607 AGTAGGCTGAGGAGGAGGAAGGG - Intergenic
1148966432 17:51439875-51439897 AGAGCTCTGAAGATGAGGACTGG + Intergenic
1149185588 17:53993275-53993297 AGTAGCCTCAAGATGGGGACTGG - Intergenic
1149259121 17:54859761-54859783 AGTAGGCTGAAGAGGAGGAGGGG + Intergenic
1149383841 17:56122599-56122621 AATAGTCTGAAGCAGAAGAAGGG - Intronic
1150817770 17:68407901-68407923 AGTAGTATGTTGAAGAGGAGTGG + Intronic
1153860370 18:9197765-9197787 AGTAGACTGAGGAAGAGGAGGGG + Intronic
1157053984 18:44203054-44203076 AGTACTATGTAGAAGAGGAGTGG - Intergenic
1158239219 18:55358360-55358382 AGTAGTATGAGGAGGAGGATGGG + Intronic
1158647900 18:59264211-59264233 TGTAGGCTGGAGAAGCGGACTGG + Intergenic
1159757830 18:72387940-72387962 AGCAATCTGAAGAAAAGGAATGG + Intergenic
1161455339 19:4367032-4367054 GGTAGGAGGAAGAAGAGGACAGG + Intronic
1162491702 19:10996208-10996230 TGTAGGCTGAAGATGAGGAGGGG + Exonic
1162611613 19:11759376-11759398 AGTAGGCTGAATAAGAGGAGGGG - Intergenic
1162613717 19:11778111-11778133 AGTAGACTGAATAAGAGGAGGGG + Intronic
1162686744 19:12392875-12392897 AGTAGGCTGAGTAAGAGGAGGGG - Intronic
1162691093 19:12432649-12432671 AGTAGGCTGAGTAAGAGGAGGGG - Intronic
1163469423 19:17487861-17487883 AGTAGACAGATGGAGAGGACGGG - Intronic
1165877755 19:39021390-39021412 AGTAGGCTGAAGAGGAGGGCTGG - Intronic
1166024187 19:40065481-40065503 ACCACTCTGAAGAAGGGGACAGG - Intergenic
1166158978 19:40937493-40937515 AGAAGACTGAAGAGAAGGACAGG + Intergenic
1166167929 19:41005415-41005437 AGAAGACTGAAGAGAAGGACAGG + Intronic
1166266834 19:41689668-41689690 AGTAGGCTGAGGAGGAGGAAAGG - Intronic
1167535474 19:50048316-50048338 AGTAGTCTTATGAAAAGCACTGG + Exonic
1168503749 19:56915649-56915671 AGTAGGCTGAAGAAGAGCAATGG + Intergenic
929620311 2:43348022-43348044 AGTAGTCTAGACAAGAGGAGGGG + Intronic
930073446 2:47387959-47387981 AGTAGGCTGAGGAAGAGGAAGGG + Intergenic
931642872 2:64396816-64396838 AAGAGACTGAAGAAGAGGAGGGG - Intergenic
932032328 2:68202723-68202745 AGTAGTCTCAAGTAAAGGACTGG - Intronic
932682020 2:73834535-73834557 AGTAGGCTGAGGAAGAGGAGGGG + Intronic
932737172 2:74262397-74262419 AATAGTCTGAACAAGATTACAGG + Intronic
933099430 2:78233405-78233427 AGTAGGCCAAAGAAGAGGAAGGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
934177422 2:89587830-89587852 AGTACTATGTTGAAGAGGACTGG + Intergenic
934287721 2:91662132-91662154 AGTACTATGTTGAAGAGGACTGG + Intergenic
934310176 2:91855776-91855798 AGTAGTATGTTGAAGAGGAGTGG - Intergenic
935230656 2:101093004-101093026 AGTAGTCTGAAGAGGAGGAGGGG - Intronic
937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG + Intergenic
937751221 2:125478005-125478027 AGTAGGGTGAGGAAGAGGAGGGG - Intergenic
942344317 2:174986636-174986658 AGTAGACTGAAGAAGAGGAGGGG - Intronic
943764514 2:191646250-191646272 AGATCTCTGAAGAAGGGGACTGG + Intergenic
945034879 2:205696197-205696219 GGTAGTCTAAAGCAGAGGTCTGG + Intronic
945473407 2:210253429-210253451 AGCAGTCTGAACAGGAGAACCGG - Intergenic
945743383 2:213690667-213690689 AGCAGGCAGAAGAAGAGGATAGG + Intronic
946773532 2:223113590-223113612 AGTAGTCTGAAAGATAGGAAAGG + Intronic
948033277 2:234837096-234837118 ATTAGTAGGAAGAAGAGGAGAGG - Intergenic
1169786454 20:9364407-9364429 AATGCTCTGAAGAAGTGGACAGG - Intronic
1170835339 20:19878973-19878995 AGACGTCTGAACAAGAGGATGGG + Intergenic
1171517588 20:25750347-25750369 AGTACTCTGTGGAAGAGCACAGG - Intergenic
1172091943 20:32439174-32439196 AGCAGAGGGAAGAAGAGGACTGG - Exonic
1172651510 20:36505873-36505895 AGTACACTGAGGAAGAGGAATGG + Intronic
1172963123 20:38812772-38812794 AGGAGTTTGAAGGAGAAGACTGG + Intronic
1173021997 20:39274644-39274666 AGAAGAATGTAGAAGAGGACAGG - Intergenic
1174970808 20:55273584-55273606 TTTAGTCTGAAGAAGAAGAGAGG - Intergenic
1175165346 20:57039617-57039639 ATTAGTTTCAAGAAGAAGACAGG + Intergenic
1177475383 21:21613892-21613914 AGTAGGCTGAAGAAGAGACTGGG + Intergenic
1178431204 21:32520245-32520267 AATTCTCTGTAGAAGAGGACAGG - Intergenic
1179345882 21:40556928-40556950 AGTAGGCTGAGGAAGAGGAGGGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1182325193 22:29507259-29507281 AATAGTCTAAGGAAGAGGAGGGG - Exonic
1182506687 22:30788240-30788262 AGTAGGAAGAGGAAGAGGACGGG + Intronic
1182539553 22:31030859-31030881 AGTAGGCTGAGGAAGAGGAGGGG - Intergenic
1182554576 22:31122387-31122409 AGGTGTCTGCAGAAGAGGAGGGG + Intergenic
1182799553 22:33020429-33020451 GGGTGTCTGAAGAGGAGGACAGG + Intronic
951159296 3:19397267-19397289 AGTAGTGGCAAGAAGAGCACTGG + Intronic
951463295 3:22974281-22974303 AGTAGTCTGTTGAAGAGGAATGG - Intergenic
951632430 3:24736472-24736494 AGTAGTTGGAAGAAGAGGGATGG + Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956525405 3:70154341-70154363 AGTAAACTGAGGCAGAGGACAGG + Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
956774143 3:72550881-72550903 AGTAAGCTGAGGAAGAGGAGAGG - Intergenic
957874587 3:86129294-86129316 AGTAATCTGAAGAAGACAGCAGG - Intergenic
958119890 3:89271912-89271934 AGTAAGCTGAAAAAGAGGAAGGG - Intronic
959287217 3:104430140-104430162 AGTAGTATGAAGAAAAGACCAGG - Intergenic
961182122 3:124886165-124886187 AGGATTCTGGAGCAGAGGACAGG - Intronic
961965641 3:130899496-130899518 AGTAGGCTGAAGAAAAGGAGGGG + Intronic
962084832 3:132179815-132179837 AGTTGTCTGGAGTAGAGGAATGG - Intronic
964644172 3:158940553-158940575 AGTACTATGTTGAAGAGGACTGG - Intergenic
964915995 3:161842728-161842750 AGTACTCTGTTGAAGAGGAGTGG + Intergenic
965656159 3:170987564-170987586 ATTAGTTTGACGATGAGGACTGG + Intergenic
965738699 3:171849977-171849999 AGTTGGCTGAAGAGGAGGCCAGG - Intronic
967047560 3:185751667-185751689 CATAATCTGATGAAGAGGACAGG + Intronic
968226958 3:196978816-196978838 AGTGGTCAGAAGAAGAAAACAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972263964 4:37440655-37440677 GCTAGTCTGAAAAAGAAGACTGG - Intronic
974875015 4:67693172-67693194 AGTAGGCTGAGGAGGAGGAAGGG - Intronic
974882554 4:67777858-67777880 AGTTATCTGAAAAAGAGGTCTGG + Intergenic
976223464 4:82777016-82777038 AGAAGTCTGCAGAAGAGCATGGG - Intronic
976270975 4:83230090-83230112 AAAAGTCTGGAGTAGAGGACAGG - Intergenic
977177439 4:93834522-93834544 AGGAGTATAAAGAAAAGGACAGG + Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977265101 4:94844587-94844609 AGGAGCCTGAAGCAGAAGACCGG + Intronic
977757689 4:100692921-100692943 AGAATTTTGAAGAAGAGGAGAGG - Intronic
979301798 4:119095168-119095190 AGGAGTCTGGAGAAGAGAAATGG - Intergenic
979727055 4:123974762-123974784 AGTAGACTGAAGTACAGGAAGGG - Intergenic
982119267 4:152125361-152125383 AGTACTCTGTTGAAGAGGAGTGG + Intergenic
982785932 4:159537053-159537075 AGTAGTCTGATCAAGAGCATAGG - Intergenic
983283303 4:165708266-165708288 AGTAGGATGAGGAAGAGGAGGGG - Intergenic
983411417 4:167403206-167403228 AGCAGTTTGAGGAAGAGGAAAGG - Intergenic
984527218 4:180871820-180871842 AGTAGTATGTTGAAGAGGAGTGG + Intergenic
988085021 5:26464030-26464052 AGTAGGCTGAAGAAGAGAAGGGG - Intergenic
988363462 5:30265865-30265887 AGTTGTCAAAAGTAGAGGACTGG + Intergenic
988880134 5:35493548-35493570 AGTAGACTGAGGAGGAGGAGGGG + Intergenic
990031958 5:51272197-51272219 AGAAGAGTGAAGAAGAAGACTGG + Intergenic
990325793 5:54674099-54674121 AGTAGTGGGGAGAAGAGGAAGGG + Intergenic
992013644 5:72555336-72555358 TGCACTCTGAAGAAGAGGAAGGG + Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
993615011 5:90100289-90100311 AGTTTTCTGAGGAAGAGAACAGG - Intergenic
993949631 5:94158046-94158068 AGTGTTCTGAATAAGAGCACAGG + Intronic
994913543 5:105944023-105944045 AATACTGGGAAGAAGAGGACAGG - Intergenic
997119718 5:131161896-131161918 AGTAGGCTGAGGAAGACGAGGGG - Intronic
997675865 5:135712820-135712842 CGGAGTCTGAAGAAGGGAACAGG - Intergenic
997913701 5:137902433-137902455 AGTAGGCTGAGGAGGAGGAGGGG - Intronic
999170858 5:149593809-149593831 AGTAGGCTGAGGAGGAGGAGGGG + Intronic
999876777 5:155815776-155815798 AGGAGTCTGAGGAAGGTGACTGG - Intergenic
1001663554 5:173414045-173414067 AGTAGGCTGAAGAAGAGGGAGGG - Intergenic
1002866579 6:1127254-1127276 AGTGGCCTGGAGAAGAGGTCTGG + Intergenic
1004244192 6:13956623-13956645 AGTAGTCTAACGCAAAGGACAGG - Intronic
1004487003 6:16076000-16076022 AGGAGGCTGAAGAGGAGGAGGGG - Intergenic
1006338344 6:33432318-33432340 AGGAGTCTGAGAAAGAGGGCAGG + Intronic
1008433641 6:51449807-51449829 CGTAGTCTGTAGAAGATGAATGG + Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009489463 6:64270770-64270792 AGGAGTGTGAGGCAGAGGACTGG - Intronic
1010951464 6:82041689-82041711 AGTAGGCTGAGGAAGAGGAGGGG - Intergenic
1012835143 6:104255084-104255106 TGTGCTCTGAAGAAGAGGAAAGG - Intergenic
1013940719 6:115658269-115658291 AGTACTCTGCTGAAGAGGAGTGG + Intergenic
1014454211 6:121618724-121618746 AGTAGCCTGCTGAAGAGGAAAGG - Intergenic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1014751811 6:125265554-125265576 AGTAGGCTGCAGAAGGGGAGAGG - Intronic
1016571677 6:145520420-145520442 AGTAGCTGGAAGAAGAGTACAGG - Intronic
1017787965 6:157772187-157772209 TGGAGTGTGAAGGAGAGGACAGG + Intronic
1017984294 6:159429503-159429525 AGTAGGCTGAGGAAGAGGAGGGG + Intergenic
1019261901 7:86477-86499 AGGAGGCTGAAGAAGAGCTCAGG - Intergenic
1021278914 7:18692147-18692169 AGTATTCTTAAGAAGAGTAATGG - Intronic
1021924706 7:25523164-25523186 AGTAGTTTCAAGATGGGGACTGG + Intergenic
1022499751 7:30875212-30875234 AGTAGCCTGCAGCATAGGACAGG + Intronic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1026297537 7:69068046-69068068 CGAACTCAGAAGAAGAGGACTGG + Intergenic
1027403750 7:77836229-77836251 AATAGGTTGAAGAAGAGGAGGGG + Intronic
1029994400 7:104992921-104992943 AGTAGGCTGAGGAAGAGGAGGGG - Intergenic
1030270985 7:107667994-107668016 AGTTGTCTCAAGGAGAGGAAAGG + Intronic
1030971686 7:116065050-116065072 AGTATTCTGGAGAATAGAACTGG - Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1032980247 7:137273745-137273767 AGTAGTCTGGAGAAGAGACAAGG + Intronic
1034233399 7:149550198-149550220 AGTAGGCTGAAGAAGAAAAGAGG + Intergenic
1036681929 8:10881015-10881037 AGTAGGCTGAATGAGAGGAAAGG - Intergenic
1037013396 8:13873355-13873377 AGTAGGCTGAGGAGGAGGAGGGG + Intergenic
1037180977 8:16005426-16005448 AGAAGACTAAAGAAGAGGCCGGG + Intergenic
1038098896 8:24349847-24349869 AGAAGTCTGCAGCAGAGAACAGG - Exonic
1038813816 8:30880496-30880518 AGTAGGCTAAGGAAGAGGAGGGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1045410261 8:101910172-101910194 AGTGGTCCCAAGAAGAGGATGGG + Intronic
1045881273 8:107043699-107043721 AGTACTCTGTTGAAGAGGAGTGG - Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046695975 8:117340075-117340097 AGCAGTCTGAAAAAGAGTGCAGG - Intergenic
1047626413 8:126660604-126660626 AGGAGGCTGAAGAAGAGGCTTGG + Intergenic
1050349957 9:4731849-4731871 AGTAGACTGAGGAGGAGGAGGGG - Intronic
1052265370 9:26565854-26565876 ACTAGGCTGAGGAAGAGGAGGGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052715904 9:32116883-32116905 ATTAGTCTGAAGAGGAAGCCAGG + Intergenic
1053454710 9:38225187-38225209 AGTCAACTGAAGAAGAGCACAGG - Intergenic
1056798137 9:89673405-89673427 AGCAGGCTGAGGAGGAGGACAGG + Intergenic
1057474162 9:95384627-95384649 AGTGGTGTCAAGAAAAGGACTGG - Intergenic
1057736440 9:97665984-97666006 AGTAGGCTGAGGAAGAGGAGGGG + Intronic
1059036871 9:110763655-110763677 ATTTGTCTGAAGCAGAGGAGAGG + Intronic
1059875938 9:118634827-118634849 AGTAGGCTGAGGAAGAGGAGGGG + Intergenic
1060576328 9:124698869-124698891 TTTAGTCTGAAGAACAGGAAGGG - Intronic
1186033512 X:5395382-5395404 AGTAGGCTGAGGAGGAGGAAGGG + Intergenic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1186812609 X:13205119-13205141 AGTAGGCTGAGGAAGAGGAGCGG + Intergenic
1188045544 X:25422383-25422405 AGTACTATGTTGAAGAGGACTGG + Intergenic
1189337640 X:40180019-40180041 AGTTGGATGAGGAAGAGGACAGG - Intergenic
1190730494 X:53222640-53222662 AGTAGTCTGGAGATGAAGGCAGG - Intronic
1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG + Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192747170 X:73950773-73950795 AGTAGGCTGAGGAAGAGGAGGGG + Intergenic
1192967927 X:76199657-76199679 AGTACTGTGTAGAAGAGGAGTGG + Intergenic
1193793601 X:85846430-85846452 AGTAGTATGTTGAATAGGACTGG - Intergenic
1193805939 X:85994517-85994539 AATATTCTGAAGTAGAGGATAGG - Intronic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193862925 X:86693473-86693495 AGAATACTGAAGAGGAGGACTGG + Intronic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194426578 X:93746400-93746422 GGTAGTCTGACGCAGAGCACTGG + Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194795519 X:98207415-98207437 AATAGGCTGAAGAGGAGGAAGGG - Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198255937 X:134924520-134924542 AGTGTTCTGAACAAGGGGACAGG - Intergenic
1198428123 X:136540121-136540143 AATAGACTGAAGGAGAGGAAGGG - Intronic
1198510633 X:137347629-137347651 AGTACTATGATGAAGAGGAATGG - Intergenic
1198668819 X:139055208-139055230 AGTACTATGTAGAAGAGGAGTGG + Intronic
1199168572 X:144707642-144707664 AGTAGGCTGAAGAGGAGAAGGGG - Intergenic
1199711386 X:150472145-150472167 AGTAATTTCAAGAAGAGCACAGG - Intronic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201379354 Y:13356501-13356523 AGAAGTCTGAAAAAGTGGAAAGG + Intronic