ID: 1107255473

View in Genome Browser
Species Human (GRCh38)
Location 13:38421040-38421062
Sequence TCCATAGTTTGGAGTAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107255473_1107255476 19 Left 1107255473 13:38421040-38421062 CCTTATTTACTCCAAACTATGGA No data
Right 1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG No data
1107255473_1107255479 27 Left 1107255473 13:38421040-38421062 CCTTATTTACTCCAAACTATGGA No data
Right 1107255479 13:38421090-38421112 CTAGAAGAGTGAAGGCCTCCTGG 0: 27
1: 53
2: 45
3: 55
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107255473 Original CRISPR TCCATAGTTTGGAGTAAATA AGG (reversed) Intergenic
No off target data available for this crispr