ID: 1107255473 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:38421040-38421062 |
| Sequence | TCCATAGTTTGGAGTAAATA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1107255473_1107255476 | 19 | Left | 1107255473 | 13:38421040-38421062 | CCTTATTTACTCCAAACTATGGA | No data | ||
| Right | 1107255476 | 13:38421082-38421104 | CTACCCATCTAGAAGAGTGAAGG | No data | ||||
| 1107255473_1107255479 | 27 | Left | 1107255473 | 13:38421040-38421062 | CCTTATTTACTCCAAACTATGGA | No data | ||
| Right | 1107255479 | 13:38421090-38421112 | CTAGAAGAGTGAAGGCCTCCTGG | 0: 27 1: 53 2: 45 3: 55 4: 162 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1107255473 | Original CRISPR | TCCATAGTTTGGAGTAAATA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||