ID: 1107255476

View in Genome Browser
Species Human (GRCh38)
Location 13:38421082-38421104
Sequence CTACCCATCTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107255473_1107255476 19 Left 1107255473 13:38421040-38421062 CCTTATTTACTCCAAACTATGGA No data
Right 1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG No data
1107255474_1107255476 8 Left 1107255474 13:38421051-38421073 CCAAACTATGGAAAAAGAGACCT No data
Right 1107255476 13:38421082-38421104 CTACCCATCTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107255476 Original CRISPR CTACCCATCTAGAAGAGTGA AGG Intergenic
No off target data available for this crispr