ID: 1107255479

View in Genome Browser
Species Human (GRCh38)
Location 13:38421090-38421112
Sequence CTAGAAGAGTGAAGGCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 27, 1: 53, 2: 45, 3: 55, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107255475_1107255479 -4 Left 1107255475 13:38421071-38421093 CCTAACAAATGCTACCCATCTAG No data
Right 1107255479 13:38421090-38421112 CTAGAAGAGTGAAGGCCTCCTGG 0: 27
1: 53
2: 45
3: 55
4: 162
1107255474_1107255479 16 Left 1107255474 13:38421051-38421073 CCAAACTATGGAAAAAGAGACCT No data
Right 1107255479 13:38421090-38421112 CTAGAAGAGTGAAGGCCTCCTGG 0: 27
1: 53
2: 45
3: 55
4: 162
1107255473_1107255479 27 Left 1107255473 13:38421040-38421062 CCTTATTTACTCCAAACTATGGA No data
Right 1107255479 13:38421090-38421112 CTAGAAGAGTGAAGGCCTCCTGG 0: 27
1: 53
2: 45
3: 55
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107255479 Original CRISPR CTAGAAGAGTGAAGGCCTCC TGG Intergenic
905159356 1:36017954-36017976 CCAGAAGAGTGAAGGCCTCCTGG + Intronic
906203833 1:43976334-43976356 GTGGAGGAGTGAAGGCCCCCAGG + Exonic
907211832 1:52830342-52830364 GTAGAAGAGTGAAGGCCTCCTGG + Intergenic
907484681 1:54769001-54769023 CTAGCAGAGTGGAGGCCAGCAGG + Intergenic
907511264 1:54962461-54962483 CTAGAAGAATGAAGGCCTCCTGG - Intergenic
907585908 1:55617684-55617706 CTAGAAGAGAAAATGCTTCCTGG - Intergenic
908487278 1:64607134-64607156 GTAGAAAAGAGAAGGGCTCCAGG + Intronic
908732638 1:67242158-67242180 CTAGAAGAGTGAAGGCCTCCTGG + Intronic
909209979 1:72810708-72810730 CTAGAAGACTGAAGGCCTCCTGG + Intergenic
909576122 1:77178287-77178309 CTAGAAGTATGAAGGCCTCCTGG - Intronic
909825013 1:80116815-80116837 CTGGAAGAGTGAAGGCCTACTGG + Intergenic
910730630 1:90392095-90392117 CTAGAAGAGGGAAGGCCCAGCGG - Intergenic
910809639 1:91223084-91223106 TTAGAAGAGTGAAGGCCTTCTGG - Intergenic
913130639 1:115835368-115835390 CTAGAGGTGAGAAGGCCTACAGG + Intergenic
916035204 1:160915878-160915900 CTAGAAGAGTGAAGACCTCCTGG + Intergenic
916640553 1:166724394-166724416 CTACAAGAGTGAAGGCCTCCTGG - Intergenic
917834918 1:178933884-178933906 CTAGCAGAGGGCAGGGCTCCTGG - Intergenic
917978860 1:180257033-180257055 CTAGAAGAGTCCAGACCACCAGG - Intronic
918330202 1:183452646-183452668 CAAGAAGAGTAAAGGCTACCCGG - Intergenic
918465312 1:184815810-184815832 CTAGAAGAGTGAAGGCCTCCTGG - Intronic
922158350 1:223058333-223058355 CTAGAAGAGTGAAGGCCTCCTGG + Intergenic
922847432 1:228698661-228698683 CCAGAAGAGTGAAGGCCTCCTGG + Intergenic
924710194 1:246524854-246524876 CTAGAAGAGTGAGCCCCTACAGG - Intergenic
1063284562 10:4671518-4671540 CTAGAAGACTGATTGCTTCCAGG - Intergenic
1063322748 10:5066966-5066988 CTAAAAGAGTGAAGGCCTCCTGG + Intronic
1065807218 10:29405332-29405354 CTGTAAGAGTGAAGGTCTTCTGG + Intergenic
1066976430 10:42372244-42372266 CCAGAAGAGTGAAGGCCTTCTGG + Intergenic
1070332945 10:75431173-75431195 TTAGAAGGTTGAAGGACTCCTGG - Intergenic
1076654375 10:132013446-132013468 TTAGAATAGTGAAGACCTCCTGG - Intergenic
1077267750 11:1660573-1660595 GGAGAAGAGAGAAGGCCTCCAGG + Intergenic
1079390241 11:20015910-20015932 TTAGAGGAGTGAACACCTCCAGG - Intronic
1080654677 11:34249517-34249539 TTACAAGAGGGCAGGCCTCCTGG + Intronic
1080810006 11:35694307-35694329 CTAGAAGAGTGAAAGCTTCCTGG + Intronic
1083011848 11:59408931-59408953 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
1083376653 11:62228820-62228842 CTGGAAGTGTGAAGGCCTCCTGG - Intergenic
1083906051 11:65671532-65671554 CTCGGAGTCTGAAGGCCTCCAGG - Intergenic
1084037259 11:66519721-66519743 CTAAAATGGTGAAGGCCTCGGGG - Exonic
1085574733 11:77591968-77591990 ATAGAAGAGTGAAGGGGGCCGGG + Intronic
1087226905 11:95611430-95611452 CTAGAAGAGTGAAGGTCTCCTGG + Intergenic
1087524704 11:99295525-99295547 CTAGAAGACTGAAGGCCTCCTGG + Intronic
1088103812 11:106183569-106183591 TTAGAAGAGTGAAGGCCTTCTGG - Intergenic
1088104392 11:106189630-106189652 ATGAAAAAGTGAAGGCCTCCTGG - Intergenic
1089700731 11:120242297-120242319 CTTGAACAGTAAAGGCCACCAGG - Intronic
1090292883 11:125561321-125561343 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
1093356234 12:18171832-18171854 CTAGAAGATTGAAGGCCTCCTGG - Intronic
1094024235 12:25945518-25945540 CTGGAAGGATGAAGGCCTCCTGG + Intergenic
1094239597 12:28206894-28206916 CCAGGGAAGTGAAGGCCTCCAGG + Intronic
1098004864 12:65985588-65985610 CTTGAAGAGTGAAGGCCTCCTGG + Intergenic
1098711969 12:73774187-73774209 CCAGAAGAGTGAAGGCCTCCTGG - Intergenic
1099799046 12:87433963-87433985 CTAGAAGAACGAAGACCTCTTGG - Intergenic
1100159167 12:91837659-91837681 CCAGAAGAGTGAAGGCCTCTTGG + Intergenic
1100858717 12:98781805-98781827 CTAGAACAATGAAGCCCTCCAGG + Intronic
1101189407 12:102315853-102315875 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
1103125919 12:118422271-118422293 GGATAAGAGTGAAGGTCTCCAGG - Intergenic
1104598419 12:130136055-130136077 CTTGAGGAGTCAAGGCCTCAAGG + Intergenic
1105270470 13:18869947-18869969 CTGAATGAGTGAAGGCATCCTGG + Intergenic
1105504513 13:20998619-20998641 CTGGAAGAATGAGGCCCTCCGGG + Intronic
1106920289 13:34556077-34556099 CTAGCATATTGAAGGCCTGCAGG + Intergenic
1107111467 13:36702502-36702524 CTAGGAGAGTGAAGACCCCCTGG + Intergenic
1107229298 13:38088324-38088346 CTAAAAGAGTGGAGGCCTCCTGG + Intergenic
1107255479 13:38421090-38421112 CTAGAAGAGTGAAGGCCTCCTGG + Intergenic
1107712461 13:43163802-43163824 CTGGAAGAGTGAAGGAATCAAGG - Intergenic
1109690655 13:65883888-65883910 TTTGAATAGTGAAGGCCTCAAGG + Intergenic
1110050156 13:70886910-70886932 TTAATAGAATGAAGGCCTCCTGG - Intergenic
1110960102 13:81610610-81610632 CTAAAAAAGTGAAGGCCTCCTGG - Intergenic
1113445361 13:110362063-110362085 CTAGAAGAGTGAGGCTCTCCGGG + Intronic
1113968457 13:114168857-114168879 CCAGAAGAGTGAAGGCTTCCTGG + Intergenic
1114912220 14:27214571-27214593 CTAAAAGAGTGAAGGCCTCCTGG + Intergenic
1115543764 14:34446639-34446661 CTAGAAGAGGGAAGGCCTCCTGG - Intronic
1115716988 14:36116905-36116927 CTAGAAGAGGGAAGACCTTATGG - Intergenic
1115907852 14:38221201-38221223 CCAGAAGAGCAAACGCCTCCTGG + Intergenic
1116483917 14:45424032-45424054 CTAGAAGAGTAAAGGCCTCCTGG - Intergenic
1116576589 14:46583062-46583084 TTAGAAGAGTGAAGGCCTCCTGG + Intergenic
1116725627 14:48558399-48558421 ATAGAAGAGTGAAGGCCTCCTGG + Intergenic
1119670180 14:76512534-76512556 CAAGAAGAGTGCAGGCCACCAGG + Intergenic
1120240230 14:81941054-81941076 CTAGAATAGTAGAGGCATCCAGG + Intergenic
1120649790 14:87118430-87118452 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
1121268142 14:92617978-92618000 CTAGAAGAGTGAAGGCCTCCTGG + Intronic
1122758663 14:104003465-104003487 CTAGAAGGGTGAAGGCCTCTTGG - Intronic
1124039670 15:26089361-26089383 CTAGAAGAGTGAAGCTCTCCTGG + Intergenic
1124184562 15:27512646-27512668 ATAGAAGGGAGAAGGTCTCCAGG + Intronic
1124614816 15:31234028-31234050 CTAGGAGAGTGATGGTCTCTAGG + Intergenic
1124688240 15:31800296-31800318 GTACAAGAGTACAGGCCTCCCGG - Intronic
1125630814 15:41145594-41145616 TTAGAAGAGTGAAGGACTCCTGG + Intergenic
1126447164 15:48760572-48760594 CTGGGAAAGAGAAGGCCTCCTGG + Intronic
1126474688 15:49053634-49053656 CCAGAAAGGTGAAGTCCTCCTGG + Intergenic
1127371259 15:58343975-58343997 CTGGAAGCATGAAGGCTTCCTGG + Intronic
1129260277 15:74362974-74362996 TCAGAAGAGTGAAGGACTTCTGG - Intronic
1131049516 15:89337260-89337282 CAGGAAGGGTGCAGGCCTCCAGG - Intergenic
1134284297 16:12846738-12846760 CCAGAAGATGGAAGGCCTGCTGG + Intergenic
1135805921 16:25542524-25542546 CTAGAAGGACGAAGGCCTGCTGG - Intergenic
1136382771 16:29903987-29904009 CGAGAAAAGAGAAGGCTTCCTGG - Intronic
1136638920 16:31545550-31545572 CGACAAGCGTGAAGGCCTCCTGG + Intergenic
1136931971 16:34426800-34426822 CCAGAAGAGTGAAGGCCTCTTGG + Intergenic
1136972601 16:34985015-34985037 CCAGAAGAGTGAAGGCCTCTTGG - Intergenic
1137870048 16:51941098-51941120 CAAGAATAGTGGAGGCCACCAGG + Intergenic
1139214097 16:65110485-65110507 CGAGAAGAGTGAAGGCACCACGG + Intronic
1141180771 16:81752219-81752241 CTAGAATTGTGAGGGCCTCCAGG - Intronic
1142603244 17:1067529-1067551 CAAGAAGAGCGAAGCCTTCCTGG + Intronic
1144426676 17:15149481-15149503 TTAGAAGAGTGAAGGCCTCCTGG - Intergenic
1146369798 17:32258463-32258485 CTGGAAGAGTCAAGGACTCCAGG - Intergenic
1147463874 17:40595134-40595156 CTAGAAGAGTGAAGGCCTCTTGG - Intergenic
1150339609 17:64355976-64355998 CTAGGAGAGTAATGTCCTCCAGG - Intronic
1153118172 18:1686524-1686546 CCAGAAGAGTGAAGACCTCCTGG + Intergenic
1153965040 18:10172156-10172178 CTAGAAAGGTGAAGGCTTTCTGG + Intergenic
1154365679 18:13706573-13706595 CTAGAAGAGTGAAGGCCTCCTGG - Intronic
1155803427 18:30137302-30137324 TTAAAAGAATGAAGGCCTTCTGG + Intergenic
1156245135 18:35290479-35290501 CTTGGAGAGTGAAGGCCCCCGGG + Intergenic
1156797743 18:41068759-41068781 CTAGAGGAGTGAATGTCTCCAGG - Intergenic
1157013306 18:43678862-43678884 CTAGAAGACTGAAGGCCTCCTGG + Intergenic
1158905293 18:62005742-62005764 CTGCAAGAGTGGAGGCCTCATGG - Intergenic
1160262931 18:77312446-77312468 CTAGAAGAGTGAAGGCCTCCTGG + Intergenic
1162062594 19:8106006-8106028 GTAGAGGAGGGAAGGCCTCATGG - Intronic
1162728875 19:12705906-12705928 TGAGAAGAATGAAGGCCTCGAGG - Intronic
1163509556 19:17726827-17726849 CTCGAAGAGAGAGGGCCTCCTGG + Exonic
1163982788 19:20916979-20917001 TCAGAAGAGTAATGGCCTCCTGG - Intergenic
1163992826 19:21015014-21015036 ATTGAAGAGTAATGGCCTCCTGG - Intergenic
1164042088 19:21502025-21502047 TCAGAAGAGTAATGGCCTCCTGG - Intronic
1164461334 19:28451380-28451402 TTAGAAAAGTGAAGGCCTTCTGG - Intergenic
1165403190 19:35614760-35614782 CTAGAAGTCCCAAGGCCTCCTGG - Intronic
1165653925 19:37516598-37516620 CTAGAAGAGTGCCGGACTGCAGG + Intronic
1168557655 19:57356565-57356587 CAAGAAGAGTAAAGGTGTCCAGG - Exonic
925237661 2:2293543-2293565 TTAGAAGAACGAAGGCTTCCAGG + Intronic
926522053 2:13927698-13927720 CTAGAAGAGTGAAGGCCACCTGG - Intergenic
927105842 2:19824481-19824503 CTAGAATGGTGAATGCTTCCTGG + Intergenic
928076339 2:28268172-28268194 CTAAAAAAGTGAAGGTGTCCTGG + Intronic
928382635 2:30832920-30832942 CTAGAAGAATGAAGGCCTCCTGG - Intergenic
929364539 2:41137162-41137184 CTTGTGGAGTGAATGCCTCCTGG - Intergenic
930498512 2:52179847-52179869 TCAGAAGAGTGAAGGCTTTCTGG - Intergenic
931975221 2:67636662-67636684 CTAGAAAAGAGAAGGTCCCCTGG - Intergenic
933077742 2:77950915-77950937 CTAGAAGAGTGAAGGCCTCCTGG + Intergenic
933736243 2:85497060-85497082 TCAGAAGGGTGAAGGCCTCCTGG - Intergenic
936600663 2:113890757-113890779 CTAGAAAAGAGAAGCGCTCCTGG + Intronic
936607380 2:113972049-113972071 TTAGAAGAGTGACTGCTTCCAGG - Intergenic
937674889 2:124579163-124579185 CTAGAAGAGCGAAGACCTCCTGG - Intronic
939480524 2:142742219-142742241 CAAAAAGAGAGAATGCCTCCAGG - Intergenic
940569293 2:155409906-155409928 TTAGAAGAGTGAAGGCCTTTTGG - Intergenic
942427621 2:175876540-175876562 ATAGTAGGGGGAAGGCCTCCAGG - Intergenic
943372767 2:187036283-187036305 CCAGAAGAGTGAAGGTTTCCTGG + Intergenic
943919446 2:193684662-193684684 ACAGAAGAATAAAGGCCTCCAGG - Intergenic
943948264 2:194094917-194094939 CCAAAAGGGTGAAGGCCTCTTGG - Intergenic
946095023 2:217267025-217267047 ATTGAAGAGTGAAGGCTTCCTGG + Intergenic
946296852 2:218791209-218791231 TGAGAAGAGTTAAGACCTCCTGG + Intronic
947299902 2:228677512-228677534 CTAGAGGAATGAAGACCTCCCGG + Intergenic
947952651 2:234161424-234161446 CTGGAAGAGTGCAAGCCCCCTGG + Intergenic
948732113 2:239972313-239972335 CCAGCAGAGTGAAGCCCACCCGG - Intronic
1169162975 20:3398113-3398135 CTAGAAGAGAAATGGCCTCCAGG + Intronic
1169186156 20:3618976-3618998 CAAGAAGAGTAGAGGCCTCAAGG + Intronic
1169388465 20:5170440-5170462 CTGGAAGACTGCAGGCCTCCAGG + Intronic
1170255185 20:14334627-14334649 GAAGAACAGTGAAGGCCTCTGGG + Intronic
1170677799 20:18498513-18498535 CTAGAAGAGTGAAGGCCTACTGG - Intergenic
1170970783 20:21114606-21114628 GTACAAGAGTGAAGCCATCCTGG + Intergenic
1171318506 20:24217928-24217950 ATAGAACAGTGAAGCCCTCCTGG + Intergenic
1171721759 20:28570292-28570314 CTAGAAGAGTGAAGGGCTCCTGG - Intergenic
1171756302 20:29113207-29113229 CTAGAAGAGTGAAGGGCTCCTGG + Intergenic
1171785950 20:29464686-29464708 CTAGAAGAGTGAAGGGCTCCTGG - Intergenic
1171862291 20:30412286-30412308 CTAGAAGAGTGAAGGGCTCCTGG + Intergenic
1173490783 20:43479455-43479477 CTAGAAGACTGAAGCCCCCCTGG + Intergenic
1174058474 20:47815952-47815974 CCAGAAAGGTGAAGACCTCCTGG - Intergenic
1176342645 21:5713141-5713163 CCAGAAGATTAAAGTCCTCCAGG - Intergenic
1176474899 21:7145292-7145314 CCAGAAGATTAAAGTCCTCCAGG - Intergenic
1176502182 21:7611315-7611337 CCAGAAGATTAAAGTCCTCCAGG + Intergenic
1176536966 21:8111210-8111232 CCAGAAGATTAAAGTCCTCCAGG - Intergenic
1176855743 21:13969251-13969273 CTGAATGAGTGAAGGCATCCTGG + Intergenic
1177326861 21:19601865-19601887 CTAGAATAGTGAAGGCCTCTTGG + Intergenic
1177534064 21:22401685-22401707 TTAGAAGAGTGAAGGCCTTCTGG - Intergenic
1178431722 21:32523504-32523526 CTAAAAGGGTGAAGGGCACCTGG + Intergenic
1178954534 21:37010522-37010544 CAAGCAGAGGGAAGGCCTCAAGG + Intronic
1180295315 22:10928979-10929001 CTAGAAGAGTGAAGGGCTCCTGG - Intergenic
1180413357 22:12637065-12637087 CTAGAAGAGTGAAGGGCTCCTGG + Intergenic
1182107355 22:27698844-27698866 GTAGATGAGGGAAGGCCTGCGGG - Intergenic
1182394975 22:30028670-30028692 CCCAAAGAGTGAAGGCCTCTGGG - Intronic
1184287493 22:43479702-43479724 CTAGCAGAGAGAGGACCTCCTGG - Intronic
1184410029 22:44321046-44321068 CTGGGAGACTGCAGGCCTCCAGG + Intergenic
1184513502 22:44946418-44946440 CTCGAAGAGTGCTGGCGTCCTGG + Intronic
1184618697 22:45656617-45656639 CTAGAAGAGTGAAGACCTCCTGG - Intergenic
1203241917 22_KI270733v1_random:27614-27636 CCAGAAGATTAAAGTCCTCCAGG - Intergenic
949962611 3:9325628-9325650 CTAGACGAGTGAAGGCCTCCTGG + Intronic
950503530 3:13378893-13378915 CTAGGTGAGTGTGGGCCTCCTGG - Exonic
951187210 3:19727641-19727663 GTGGAAGAGTGAAGGCCTCCTGG - Intergenic
951250334 3:20386945-20386967 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
951841567 3:27039471-27039493 TTAGAAGAATGAAGGCCTGCTGG + Intergenic
952452513 3:33445454-33445476 CTACAAGACTGAAGGCCTCCTGG + Intergenic
953817966 3:46177295-46177317 CTAGATGGGGGAAGGTCTCCTGG + Intronic
955416206 3:58694319-58694341 CTAGGTGACTGAAGGCCTCTGGG - Intergenic
957724798 3:84049993-84050015 TTAGAAAAGCGAAGGCCTCCTGG - Intergenic
957750860 3:84413525-84413547 CTAGAATAGTGAAGGCTTCCTGG - Intergenic
960597762 3:119422104-119422126 CTAGAACACTGAAGTCATCCAGG - Intergenic
960638709 3:119808183-119808205 CAGGAAGTCTGAAGGCCTCCAGG + Intronic
961344509 3:126254927-126254949 CTAGAAGAATGAAGACTTCCTGG - Intergenic
963576621 3:147068398-147068420 TTAGAAGAGGGAAGGCCTTCTGG - Intergenic
963979150 3:151516617-151516639 CTAGAAGAGTGAAGACTTCCAGG - Intergenic
963979179 3:151517000-151517022 CTAGAAGAGTGAAGACTTCCAGG - Intergenic
965084259 3:164074003-164074025 TTAGAAGAGTAAAGACCTCCTGG + Intergenic
965096072 3:164227741-164227763 CTAGAAGAGTGAAGGTTTCCTGG + Intergenic
965278685 3:166720697-166720719 CTAGAAGAGTGAAGACCTCCTGG + Intergenic
966389692 3:179438925-179438947 CTTGAAGAGTCAAGGCCTTAGGG - Intronic
966536209 3:181037160-181037182 CTAGAAGAGTGAAGGCCTCCTGG + Intergenic
966686405 3:182700501-182700523 TCAGAAGTGTGAAGGCCTCCTGG + Intergenic
968386345 4:142521-142543 CTAGAAGAGTGAAGGCCTCCTGG - Intronic
968846961 4:3048840-3048862 CTGGAAGAGTAAAGCCCTCCTGG + Intergenic
971213446 4:24641750-24641772 TTAGAAGAATGAAGACCTTCTGG + Intergenic
971650755 4:29270171-29270193 CTAGAATAGTGAAGACTTCCTGG - Intergenic
971719658 4:30229320-30229342 ACAGAAGAGTGAAGTCCTCCTGG + Intergenic
972819188 4:42679996-42680018 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
973794065 4:54405972-54405994 CTAAAATAGTGAAGGCGTTCAGG + Intergenic
973813876 4:54600258-54600280 CTACAGGACTGAAGGCCTCCTGG + Intergenic
973970365 4:56207406-56207428 CCAGGAGAGTGAAGGCCTCCTGG + Intronic
974189797 4:58489838-58489860 TTAGAAGAGTGAAGGCCTTTTGG + Intergenic
974649354 4:64734185-64734207 TTAGAATAGTAAAGGCCTTCTGG - Intergenic
975140882 4:70917114-70917136 TTAGAACAGTGAAGGCCTCCTGG + Intronic
975664894 4:76725953-76725975 CTAGAAGACTGAAGGGATCCAGG - Intronic
976122439 4:81798298-81798320 CTGGAAGACTGAAGCCCTACTGG + Intronic
976544571 4:86319725-86319747 CTAGAAGAGTTAATGTCCCCAGG + Intronic
978843022 4:113236983-113237005 CTAGAGGAGTAAAGCCATCCTGG - Exonic
978950732 4:114555926-114555948 CTAGAAGAGTGAAGGCCTCTTGG + Intergenic
979953754 4:126928044-126928066 TTAGAAGAGTAAAGGCCTAAGGG - Intergenic
980302027 4:131007986-131008008 TTAGAAGAGTGAAGACCTTCTGG + Intergenic
980814243 4:137922397-137922419 TTAGAAGAGTGAAGACCTCCTGG - Intergenic
980937021 4:139235255-139235277 TTAGAAGAGTGAAGGCCTCCTGG + Intergenic
981201303 4:141982798-141982820 TTAGAAGATTGAAGGCCCCCTGG - Intergenic
981233938 4:142392574-142392596 CTAGAAGAGTGAAAGCCTCCTGG - Intronic
982931273 4:161410168-161410190 TTAGAATAGTTAAGGCTTCCTGG - Intronic
985135947 4:186786257-186786279 CCAGGAGAGTGGAGGCCTCATGG + Intergenic
986131413 5:4935488-4935510 CTAGTAGAGTGAAGGTCCTCTGG - Intergenic
987001805 5:13667431-13667453 CTAGAAGACTGAGAGCCTCTCGG + Intergenic
987166934 5:15208762-15208784 CTAGAAAGGTGAAGGCCACAGGG - Intergenic
987603155 5:20099596-20099618 CAAGAAGAATGATGGCCTCTAGG + Intronic
987841847 5:23232458-23232480 TTAGAAGAGTGAAGGCCTTCTGG + Intergenic
988567977 5:32335500-32335522 TTAGGAGAGTGAAGGCCTCTTGG + Intergenic
989093660 5:37760346-37760368 CTAGAGCAGTGAAGACCTCCTGG + Intergenic
989336793 5:40327104-40327126 CTAGAAGAGTGAAGGCCTCCTGG + Intergenic
990290868 5:54350111-54350133 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
991565090 5:67996925-67996947 CAAGAAGAGGCAAGGCCTCCTGG + Intergenic
993807046 5:92424012-92424034 CTAGAAGAATGACGACCTTCTGG + Intergenic
993903676 5:93601315-93601337 CAAGGAGAGTGGAGGGCTCCTGG - Intergenic
994804111 5:104421205-104421227 GCAGAAGAGTGAATTCCTCCAGG - Intergenic
995325608 5:110886371-110886393 CTAGAAGAGTGAACGCTTCCTGG - Intergenic
996022496 5:118606870-118606892 CTAGAAGTGTGAAGACACCCAGG - Intergenic
997584289 5:135035261-135035283 CTGGAAGACTGAGGGCTTCCTGG - Intronic
999460921 5:151757318-151757340 CTTGGGGAGTGAAGGCCACCAGG - Intronic
1000094508 5:157959266-157959288 CCAGAAGACTGCAGGTCTCCTGG + Intergenic
1002380705 5:178826774-178826796 ATATAAGAGTAAATGCCTCCAGG - Intergenic
1002604970 5:180377592-180377614 CAAGGAGAGTGCAGCCCTCCAGG + Intergenic
1002809918 6:617765-617787 CAAGAAGAGTGAGGGCAGCCTGG - Exonic
1003767866 6:9261329-9261351 CTGCAAGGGTGAAGCCCTCCTGG - Intergenic
1004680192 6:17886479-17886501 CTAGAATAGTGAAAGCCTTCTGG - Intronic
1004765929 6:18726766-18726788 CTAGAAGAATGAAGACCTTCTGG - Intergenic
1005639406 6:27781799-27781821 TTAGAAGAGTGAAGGCCTTCTGG - Intergenic
1005670033 6:28096436-28096458 CTAGAAGACTGAAGGAATTCAGG + Intergenic
1006290673 6:33133677-33133699 CTAGAAGACTGAAGGCCTCCTGG + Intergenic
1008290974 6:49715762-49715784 CTAGAAAAGCAAAGGACTCCTGG - Intergenic
1009405226 6:63304251-63304273 CTAGAAAGGTGAAGGCCTCTTGG - Intronic
1011123731 6:83983853-83983875 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
1011153244 6:84299069-84299091 TCAGAAGAGTGAAGGCCTACTGG - Intergenic
1011357281 6:86484981-86485003 CTGGAAGAGTGAAGGCCTCCTGG - Intergenic
1012639832 6:101596034-101596056 CTAACAGAGTGAGGGTCTCCAGG + Intronic
1013411302 6:109886491-109886513 TTAGAAGAGTGAAGACCTCCTGG - Intergenic
1013422929 6:109982598-109982620 CAACAAGTGTGAAGGCTTCCAGG + Intergenic
1014162947 6:118191096-118191118 CTAGAAGAGTAAAGGCCTCCTGG + Intronic
1015494524 6:133866035-133866057 CTGGAAGAGCGAAGGCATCAGGG + Intergenic
1015512652 6:134054070-134054092 CTAGAAAATGGAAGTCCTCCAGG + Intergenic
1016854700 6:148655569-148655591 CTAGAAGAGTGAAGGCCACCTGG - Intergenic
1017348106 6:153407938-153407960 CTAGAAGAGTGAAGATCCTCTGG + Intergenic
1017386436 6:153890217-153890239 CCAGAAGGGTGAAGGCCTCTGGG - Intergenic
1019270805 7:147285-147307 CTAGAAGAGGGAAGGCCTCTTGG + Intergenic
1020647223 7:10829511-10829533 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
1020778577 7:12489628-12489650 CTAGAAGCGGGAATGCCTTCAGG + Intergenic
1020964601 7:14849386-14849408 CTAGAAGGGTGAAACCGTCCTGG - Intronic
1021699148 7:23300694-23300716 ATAGCAGGGTAAAGGCCTCCTGG - Intronic
1021891462 7:25189785-25189807 CTAGAAGAGTGAAGACCTCCTGG + Intergenic
1022098535 7:27155737-27155759 CTAGGAGAGCCAAGCCCTCCAGG - Intronic
1023057637 7:36302640-36302662 CTAGAGGCGGGAAGCCCTCCTGG + Intergenic
1026666293 7:72342586-72342608 CTAGAATAGTACAGCCCTCCAGG + Intronic
1027707631 7:81554284-81554306 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
1029016429 7:97319698-97319720 CTTGAAGGGTGAAGGCCTCCTGG + Intergenic
1029810799 7:103046429-103046451 CTAGAAGAGTGAAGGCCTCCTGG + Intronic
1029900259 7:104031767-104031789 CCAGAATAGTGAATGCCTCCTGG + Intergenic
1030144455 7:106339422-106339444 ATAGAAGAGTGAAGGCCTCCTGG - Intergenic
1031305385 7:120119656-120119678 CTAAAAGAATGAAGGCCTCTTGG - Intergenic
1031742514 7:125452691-125452713 CTAGAACAGTGAAGGCCTCCTGG + Intergenic
1032266699 7:130374654-130374676 CAAGGAGAGTGAAGGCCTATTGG - Intergenic
1032379920 7:131468018-131468040 CAAGAAGAGTGAAGGGTTGCTGG + Intronic
1033072372 7:138215873-138215895 CTAGAAGAGTGAAGGCCTCCTGG + Intergenic
1033597111 7:142866078-142866100 CAAGGAGTGTGAAGGCCGCCAGG + Exonic
1033850010 7:145483446-145483468 CTAGAAGAGTAAAGGCCTCCTGG + Intergenic
1033962881 7:146935493-146935515 CTAGAAGAGTGAAGGCCTCCTGG - Intronic
1035485028 7:159216448-159216470 CTAACAGGGTGAAGGCTTCCTGG + Intergenic
1037439771 8:18903702-18903724 CCAGAACAGTCAAGGCCCCCAGG - Intronic
1038065375 8:23958216-23958238 GGAGAAGAGAGAAGGCCTGCTGG - Intergenic
1039800608 8:40951565-40951587 CCAGAAAAGTGAAGTCATCCTGG - Intergenic
1040402717 8:47068465-47068487 CTAGAAGAGTGAAGGCTTCCTGG - Intergenic
1040630427 8:49203558-49203580 CCACAGGAGTTAAGGCCTCCCGG + Intergenic
1041814026 8:61946653-61946675 CTGGAAGAGGGAGAGCCTCCTGG + Intergenic
1042427648 8:68667246-68667268 CTAGAAAAGTAAAGGCTTCATGG + Intronic
1044310450 8:90686464-90686486 CTAGAAGAGCAAAAGCCTCCTGG - Intronic
1044888331 8:96804126-96804148 CTAGAAGAGCAAAGGCATGCAGG + Intronic
1045596903 8:103667427-103667449 CTGGAATAATGAAGGCCTTCTGG + Intronic
1046202588 8:110946866-110946888 CTAGAAGACTGAAGGCCTCCTGG + Intergenic
1046254310 8:111676045-111676067 AAAGAAGGGTGAAGACCTCCTGG - Intergenic
1046487141 8:114901542-114901564 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
1047058295 8:121192870-121192892 GTAGAAGAGTGAAGGCCCAAAGG + Intergenic
1049052601 8:140210510-140210532 ATGGAAGAGAGAAGGCTTCCCGG - Intronic
1050314548 9:4387966-4387988 TTAGAAGAGTGAAGGCCTTCTGG + Intergenic
1050401242 9:5258006-5258028 ATAGAAGAGTGAAGGCCTCCTGG + Intergenic
1050658083 9:7851516-7851538 CTAGAAGAGTGAAGGCCTCCTGG - Intronic
1053380985 9:37649986-37650008 CTGACTGAGTGAAGGCCTCCTGG - Intronic
1055970598 9:81908201-81908223 CTAGAAGAGTGAAGGCCTCATGG + Intergenic
1057227634 9:93300869-93300891 ATAGGAGAGTGACGGCCACCTGG + Intronic
1057781154 9:98051610-98051632 CTAGAGGAGTGAAGGCCTCCTGG + Intergenic
1058218062 9:102259711-102259733 CTAGAAGAGTGAAGGCCTCCTGG - Intergenic
1058286917 9:103189838-103189860 ATAGAGGAGTGAAGGCCTTCTGG + Intergenic
1059359993 9:113734678-113734700 TTATAGGAGTGAAGGCTTCCTGG - Intergenic
1060006382 9:120003731-120003753 CCAGGAGAGTGAAGCCCTCATGG - Intergenic
1061685172 9:132270475-132270497 CTAGAGGAGTGAAGGAGTCCCGG - Intronic
1202802191 9_KI270720v1_random:10083-10105 CTAGAAGAGTGAAGGGCTCCTGG - Intergenic
1203446750 Un_GL000219v1:63854-63876 CTAGAAGAGTGAAGGGCTCCTGG - Intergenic
1203458234 Un_GL000220v1:10691-10713 CCAGAAGATTAAAGTCCTCCAGG - Intergenic
1186893392 X:13982364-13982386 CTAGAAGAGTGAAGGCTTCCTGG - Intergenic
1187673575 X:21692652-21692674 CTAGAACAGTGACGCCCACCTGG + Intergenic
1189001630 X:36953999-36954021 TCAGAAGAGTGAAGACCTCCTGG - Intergenic
1189664620 X:43340538-43340560 CCAGAAGGGTGAAGGCCTCCTGG - Intergenic
1190315325 X:49146969-49146991 CTGGTAGAGGGAAGCCCTCCTGG - Intergenic
1193477006 X:81978705-81978727 ATAGAAGAATGAATGCTTCCTGG - Intergenic
1194051515 X:89074966-89074988 CTAGAAGACTGAAAGCCTTCTGG + Intergenic
1194350365 X:92819278-92819300 CTAGAAGAATGAAGCCCTCCTGG + Intergenic
1195471857 X:105239400-105239422 CTAGAAGAATGAAGGACTCCCGG + Intronic
1195558723 X:106258141-106258163 CTAGAATAGCGAAGGCCTCCTGG + Intergenic
1195835950 X:109114758-109114780 CTAGATTAGGGAAGTCCTCCTGG - Intergenic
1196542577 X:116926459-116926481 GTAGAAGAGCAAAGGCCTCCTGG + Intergenic
1196973472 X:121134235-121134257 TTGGAAGAGTGAAGGCCTCCTGG + Intergenic
1197243088 X:124140583-124140605 TTAGAAAAGTGAAGGCCTTCTGG + Intronic
1197934462 X:131726594-131726616 TGAGAAGAGTGAAGGCCCTCTGG - Intergenic
1198491473 X:137145771-137145793 CATGAAGAGGGAAGGCTTCCAGG + Intergenic
1198498519 X:137218739-137218761 TTAGAAGAGTGAAGGCCTCCTGG - Intergenic
1198949568 X:142055514-142055536 CTAGAATAGTGAAGACGTCCTGG + Intergenic
1199105795 X:143866078-143866100 CTAGAAGAGTGAAGACCTTCTGG - Intergenic
1199859564 X:151789233-151789255 CTATACAAGGGAAGGCCTCCAGG + Intergenic
1200407578 Y:2829133-2829155 CAGGAAGAGTGAAGGCCTCCTGG + Intergenic
1200658683 Y:5935920-5935942 CTAGAAGAATGAAGACCTCCTGG + Intergenic
1200734271 Y:6776909-6776931 TTAGAATAGTGAAGGCCTCCTGG + Intergenic
1201925678 Y:19284703-19284725 TAAGAAGAGTGAAGACATCCTGG - Intergenic